camp fluorescent probe and its application
A technology of fluorescent probes and expression vectors, applied in the field of cAMP fluorescent probes, can solve the problems of insufficient specificity and low brightness, and achieve a wide range of applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0098] Firstly, CNBD-N-linker1-cpEGFP-linker2-CNBD-C (Cyclic nucleotide-binding domain, CNBD, cyclic nucleotide binding domain; CNBD-N, N-terminal of CNBD; CNBD-C, C-terminal of CNBD; cpEGFP, circularly rearranged green fluorescent protein; linker, linker peptide). Screen linker1 and linker2 to obtain probe #252, whose linker1 and linker2 are WG and RV respectively ( figure 1 A). Flamindo2 and #252 were expressed in bacteria respectively. After culturing at 34°C for 15 hours, the fluorescence brightness of #252 probe was obviously 29 times higher than that of Flamindo2 ( figure 1 B). The amino acid sequence of #252 is also given ( figure 2 ).
[0099] Mesorhizobium loti MAFF303099DNA, complete genome RC (ORF sequece) (as shown in SEQ ID No. 11)
[0100] ATGTCGGTACTGCCTTTCTTAAGAATTTACGCGCCGCTCAACGCGGTGCTGGCTGCGCCTGGGTTGCTGGCGGTGGCTGCGCTCACGATACCGGACATGTCCGGACGAAGCAGACTGGCTCTGGCTGCCCTGCTCGCTGTCATCTGGGGCGCCTATCTCCTGCAACTGGCCGCGACGCTGCTCAAGCGCCGGGCGGGAGTCGTACGGGACAGGACGCCCAA...
Embodiment 2
[0104] The #252 probe was expressed in bacteria, cultured at room temperature for 2 days to collect bacterial cells, sonicated in pH=7.3 HEPES buffer (containing 150 mM KCl and 50 mM HEPES), and purified using HisPur Cobalt Resin (purchased from Pierce Corporation). The probe was dissolved in HEPES buffer at pH=7.3 through an Econo-Pac 10DG desalting column (purchased from Bio-Rad, USA), and the concentration of the probe was determined with BCA kit (purchased from Thermo scientific company, USA). . The 2mM probe solution was taken, and the response of the probe to different concentrations of cAMP and cGMP was detected by the multifunctional microplate reader Infinite M1000 PRO, and Flamindo2 was used as a control. It can be seen that the fluorescence brightness of #252 in the 440-500nm band increased to 3.5-4.15 times after adding a saturated concentration of cAMP (~500μM) ( image 3 ). Fluorescence intensity change (ΔF / F) excited at 500 nm at 50 μM cAMP concentration 0 ) ...
Embodiment 3
[0109] #252, Flamindo2, and mEGFP (monomeric green fluorescent protein) were constructed into eukaryotic expression vectors (CAG promoter) respectively, and HEK293T cells (purchased from GE) cultured in glass-bottom dishes were transfected by Lipofectamine 2000 kit. Healthcare Dharmacon), after overnight culture, cells were starved for 6 hours with serum-free, phenol red-free medium (purchased from GIBCO). Using the IX83 fluorescence microscope built by our laboratory to detect the brightness of the probe, it can be seen that the brightness of #252 is much higher than that of Flamindo2 in the resting state of cells, about 60 times higher [(3000-225) / (225-180)=61.6] ( Figure 5 A). After cells were stimulated with 60μM Forskolin and 100μM IBMX (purchased from Biyuntian Biotechnology Co., Ltd.), the concentration of cAMP increased, and the signal changes of #252 probe ranged from 100% to 250% ( Figure 5 B-C). So far, the fluorescence imaging steps of the changes of cAMP conc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More