Method for simultaneously preparing chial ortho-alkamine and chial diol through whole-cell biological catalysis

A technology of o-amino alcohol and biocatalysis, applied in the biological field, can solve the problems of substrate cost limitation and low utilization rate of raw materials, and achieve the effects of avoiding the loss of intermediate products, high selectivity and conversion rate, and increasing reaction efficiency

Inactive Publication Date: 2019-04-23
TAIYUAN UNIV OF TECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the biological method also has its limitations. The dynamic kinetic resolution of chiral o-amino alcohols has a maximum yield of only 50%, and the produced intermediate hydroxyketones are discarded, and the utilization rate of raw materials is low; α-hydroxyketones The synthesis of chiral vicinal diols by asymmetric reduction is limited by the cost of substrates in actual production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for simultaneously preparing chial ortho-alkamine and chial diol through whole-cell biological catalysis
  • Method for simultaneously preparing chial ortho-alkamine and chial diol through whole-cell biological catalysis
  • Method for simultaneously preparing chial ortho-alkamine and chial diol through whole-cell biological catalysis

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0041] Experimental Example 1: Construction of a recombinant expression vector:

[0042] Design primers according to the gene sequence (PpbauA, CV2025, BDHA, GoSCR, GDH), the transaminase MVTA gene sequence is as shown in SEQ ID NO: 1; the transaminase CV2025 gene sequence is as shown in SEQ IDNO: 2 The nucleotide sequence shown; the transaminase PpbauA gene sequence such as the nucleotide sequence shown in SEQ ID NO: 3; the carbonyl reductase BDHA gene sequence such as the nucleotide sequence shown in SEQ ID NO: 4; the The carbonyl reductase GoSCR gene sequence is the nucleotide sequence shown in SEQ ID NO:5.

[0043] The upstream primer of MVTA gene is GGGAATTC CATATG GGCATCGACACTGGCACCT, the downstream primer is CCG CTC GAG GTACTGAATCGCTTCAATCAGTG; primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., the underlined part is Nde I and xho I enzyme cleavage site, then Mycobacterium tuberculosis Mycobacterium vanbaalenii The genome is used as the ...

experiment example 2

[0045] Experimental example 2: Expression of Escherichia coli recombinant bacteria

[0046] For Escherichia coli strains, the following method is used in the present invention: inoculate the strains constructed in Example 1 into the LB medium containing Kana, 37 ° C, 180 rpm shaking culture for 8 h, and inoculate according to the inoculum size of 2%. In a shake flask filled with 50 mL of TB medium, culture at 37°C and 180 rpm, when the OD of the culture medium 600 When it reached 0.6, add IPTG with a final concentration of 0.1 mM, and induce for 12 h at 20°C and 180 rpm. The cells were collected by centrifugation at 8000 rpm for 5 min at 4°C, and washed twice with 100 mM sodium phosphate buffer, pH 7.0. Suspend the obtained bacterial cells with 100 mM sodium phosphate buffer solution with pH 7.0, sonicate them in an ice bath, and collect the supernatant by centrifugation, which is the crude enzyme solution.

[0047] co-expressed recombinant bacteria E. coli (BDHA–GDH) and ...

Embodiment 3

[0048] Embodiment 3: The influence of substrate and product in the reaction on enzyme activity

[0049] (1) Determination of the effect of phenylglycinol on the activity of transaminase: take different concentrations of phenylglycinol (10–100 mM) and 50 mM sodium pyruvate respectively, draw the curve of enzyme activity with the concentration of phenylglycinol, and compare The enzyme activity of transaminase under different phenylglycine concentration conditions determines the optimum catalytic substrate concentration of transaminase. Experimental results such as figure 2 shown. figure 2 It shows that for MVTA, as the concentration of phenylglycine increases, the enzyme activity also increases. When the concentration of phenylglycine is 50 mM, the enzyme activity begins to be inhibited. After the concentration exceeds 50 mM, the enzyme activity of MVTA begins decreased, but the decline was not obvious, and the enzyme activity was still 80% of the highest activity when the c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and provides a method for simultaneously preparing chial ortho-alkamine and chial diol through whole-cell biological catalysis. According to the method, recombinant escherichia coli E.coli(TAm), E.coli(CR) and E. coli(GDH) whole cells serve as biological catalysts, racemization ortho-alkamine serves as a substrate, a reaction is carried outin a phosphate buffering solution, and meanwhile, and chial pure diol and ortho-alkamine are simultaneously synthesized. The cascading catalysis reaction adopts two enzyme catalysts for two catalyzingsteps, wherein in the first step, through aminopherase, racemization ortho-alkamine is subjected to kinetic resolution to obtain chial pure ortho-alkamine and hydroxyl ketone; in the second step, through carbonyl reductase, hydroxyl ketone is subjected to asymmetric reduction to synthesize chial pure diol. By means of the method, racemization ortho-alkamine is catalyzed, chial pure diol and ortho-alkamine can be simultaneously prepared, and the method has the advantages of being high in catalysis efficiency, mild in reaction condition, simple in reaction process, low in energy consumption andthe like, and conforms to the principle of green chemistry.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for simultaneously preparing chiral o-amino alcohol and chiral diol by whole cell biocatalysis. Background technique [0002] Chiral o-amino alcohols and chiral diols are a very important class of compounds. It can not only participate in many life activities, but also serve as a very important chiral building block and chiral intermediate, playing a pivotal role in the fields of medicine, chemical industry, food, agriculture and functional materials. ( S )-Phenylglycine can be used in the synthesis of ( 4S , 5S )-2-phenyl-4-(methoxycarbonyl)-5-isopropyloxazoline, which is a useful chiral auxiliary for the synthesis of neurotrophic agents;( R )-Phenylglycine can be used to synthesize phosphoinositide-dependent protein kinase inhibitors;( R )-Phenylethylene glycol can be used to prepare ( R )-flufenoxetine, ( R )-fluoxetine and β-lactam antibiotics to treat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P41/00C12P13/00C12P7/18C12P7/22C12N15/70C12N15/53C12N15/54C12R1/19
CPCC12N9/0006C12N9/1096C12N15/70C12P7/18C12P7/22C12P13/001C12P41/001C12P41/006C12Y101/01184C12Y101/9901C12Y206/01
Inventor张建栋赵剑伟张朝峰常宏宏
OwnerTAIYUAN UNIV OF TECH