Method and primer group for detecting SMN1 gene mutation
A primer set and gene technology, which is applied in the field of molecular biology gene technology and the medical field, can solve the problems of unreported IonTorrent semiconductor chip sequencing technology, etc., and achieve the effect of fast detection, stable results and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1. Design of a primer set for SMN1 gene mutation detection.
[0031] Using bioinformatics knowledge and related bioinformatics software, design PCR primers with Primer Express Software 5.0 software for the SAM-related SMN1 gene exon 7 and exon 8 deletion mutation sites that can be retrieved in public databases. The sequence is as follows.
[0032] The primers used to detect the SMN1 gene sequence fragment 1 are a pair of primers consisting of SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence listing.
[0033] Upstream primer: 5'-agtagaattaagactatcaacttaatttctgatca-3' SEQ ID No: 1;
[0034] Downstream primer: 5'-ccttccttctttttgattttgttt-3' SEQ ID No: 2.
[0035] The primers used to detect the SMN1 gene sequence fragment 2 are a pair of primers consisting of SEQ ID NO: 3 and SEQ ID NO: 4 in the sequence listing.
[0036] Upstream primer: 5'- agtagaattagtaataaccaaatgcaatgtgaa -3' SEQ ID No: 3;
[0037] Downstream primer: 5'-ctacaacacccttctcacag-3' SEQ ID No: 4.
...
Embodiment 2
[0045] Example 2. Detection of SMN1 gene mutation.
[0046] 1) Acquisition of sample genomic DNA
[0047] Genomic DNA was extracted from whole blood samples using Qiagen DNA extraction kit.
[0048] 2) PCR amplification and sequencing
[0049] Using the sample genomic DNA extracted in step 1) as a template, multiplex PCR amplification was performed under the guidance of the primers described in Example 1 (95°C for 5 min; 95°C for 15 s, 60°C for 1 min, a total of 40 cycles), The obtained amplification products were sequentially constructed for amplicon library, ISP (Ion Sphere™Particles, Ion Microsphere) template preparation, chip loading and sequencing on the IonTorrent PGM system.
[0050] 3) Analyze and draw conclusions
[0051] Use IGV2.0 software to analyze the sequencing results, count the reading results of the SMN1 gene fragments, and determine whether the sample has SMN1 gene mutations according to the detection results. If there is no homozygous deletion of exon 7...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
