Unlock instant, AI-driven research and patent intelligence for your innovation.

Method and primer group for detecting SMN1 gene mutation

A primer set and gene technology, which is applied in the field of molecular biology gene technology and the medical field, can solve the problems of unreported IonTorrent semiconductor chip sequencing technology, etc., and achieve the effect of fast detection, stable results and good repeatability

Inactive Publication Date: 2019-07-23
上海联吉医学检验所有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] At present, there is no report that the Ion Torrent semiconductor chip sequencing technology is specifically used for the detection of SMN1 gene mutations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primer group for detecting SMN1 gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1. Design of a primer set for SMN1 gene mutation detection.

[0031] Using bioinformatics knowledge and related bioinformatics software, design PCR primers with Primer Express Software 5.0 software for the SAM-related SMN1 gene exon 7 and exon 8 deletion mutation sites that can be retrieved in public databases. The sequence is as follows.

[0032] The primers used to detect the SMN1 gene sequence fragment 1 are a pair of primers consisting of SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence listing.

[0033] Upstream primer: 5'-agtagaattaagactatcaacttaatttctgatca-3' SEQ ID No: 1;

[0034] Downstream primer: 5'-ccttccttctttttgattttgttt-3' SEQ ID No: 2.

[0035] The primers used to detect the SMN1 gene sequence fragment 2 are a pair of primers consisting of SEQ ID NO: 3 and SEQ ID NO: 4 in the sequence listing.

[0036] Upstream primer: 5'- agtagaattagtaataaccaaatgcaatgtgaa -3' SEQ ID No: 3;

[0037] Downstream primer: 5'-ctacaacacccttctcacag-3' SEQ ID No: 4.

...

Embodiment 2

[0045] Example 2. Detection of SMN1 gene mutation.

[0046] 1) Acquisition of sample genomic DNA

[0047] Genomic DNA was extracted from whole blood samples using Qiagen DNA extraction kit.

[0048] 2) PCR amplification and sequencing

[0049] Using the sample genomic DNA extracted in step 1) as a template, multiplex PCR amplification was performed under the guidance of the primers described in Example 1 (95°C for 5 min; 95°C for 15 s, 60°C for 1 min, a total of 40 cycles), The obtained amplification products were sequentially constructed for amplicon library, ISP (Ion Sphere™Particles, Ion Microsphere) template preparation, chip loading and sequencing on the IonTorrent PGM system.

[0050] 3) Analyze and draw conclusions

[0051] Use IGV2.0 software to analyze the sequencing results, count the reading results of the SMN1 gene fragments, and determine whether the sample has SMN1 gene mutations according to the detection results. If there is no homozygous deletion of exon 7...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular biology genes and medical field and particularly discloses a method and primer group for detecting SMN1 gene mutation. Nucleotide sequences ofdeletion mutation regions of exons 7 and 8 of an SMN1 gene related to spinal muscular atrophy (SMA) are analyzed, corresponding primers are designed, multiple PCR amplification is performed on specific sites of sample genome DNA, and finally, detection is carried out by an Ion Torrent semiconductor chip sequencing technology. The detection method of the invention has the advantages of large flux,high specificity and sensitivity, result stability, good repeatability, high detection speed and the like, a new way which is rapid, reliable and accurate is provided for detection, test, analysis and evaluation of the SMA in the aspect of genetics, and the theoretical basis is provided for clinical diagnosis of the disease.

Description

technical field [0001] The present invention relates to the field of molecular biology gene technology and the field of medicine, and relates to a primer set for detecting SMN1 gene mutation sites using molecular biology methods, in particular to qualitative and quantitative detection of SMN1 gene mutation sites using Ion Torrent semiconductor chip sequencing technology Related primer sets and their kits. Background technique [0002] Spinal muscular atrophy (SMA) is one of the most common fatal autosomal recessive genetic diseases. The prevalence rate is 1 / 6000~1 / 10000, ranking second among fatal autosomal recessive genetic diseases. Spinal muscular atrophy is sometimes called "progressive spinal muscular atrophy" or "spinal muscular atrophy." [0003] Among neuromuscular genetic diseases, SMA is a typical neurogenic damage disease, and it is also the most common neurogenic damage in infants and childhood that leads to delayed motor development. Due to genetic material d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q2537/143C12Q2531/113C12Q2535/122
Inventor 裘敏燕
Owner 上海联吉医学检验所有限公司