Method and application for improving fermentation enzyme production of bacillus licheniformis by knocking out spoIIQ and pcf genes

A Bacillus licheniformis and gene technology, applied in the field of genetic engineering, can solve the problems of increased viscosity of fermentation broth, liquid escape, disadvantage, etc., and achieve the effects of stable bacterial growth, improved fermentation performance and less foam output

Active Publication Date: 2019-07-26
QILU UNIV OF TECH
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The formation of spores is not conducive to high-density continuous fermentation, and will affect the control of the fermentation process, such as the increase in the viscosity of the fermentation liquid, the increase in foam, etc., affect the gas exchange, easily cause liquid escape, etc., increase the chance of bacterial contamination, and increase the cost of fermentation; in addition, Bacillus The growth process is often accompanied by bacterial autolysis, which is not conducive to the accumulation of biomass, shortens the effective fermentation cycle, and reduces the efficiency of fermentation production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and application for improving fermentation enzyme production of bacillus licheniformis by knocking out spoIIQ and pcf genes
  • Method and application for improving fermentation enzyme production of bacillus licheniformis by knocking out spoIIQ and pcf genes
  • Method and application for improving fermentation enzyme production of bacillus licheniformis by knocking out spoIIQ and pcf genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1 Construction of Recombinant Bacillus licheniformis (B.licheniformis) DL-1ΔspoⅡQ

[0065] Using the Bacillus licheniformis genome as a template, PCR amplification was performed on the upper and lower homology arms spoIIQF, spoIIQR and the fusion fragment spoIIQF-spoIIQR of the spoIIQ gene. The nucleotide sequences of the primers were as follows:

[0066] spo II QF1: CATCGCCAGTCACTAGGATCCACGCCGAGGACGTAGCCT

[0067] spoⅡQR1: TTACCGTGCTTGGCATTATCCCTCGCTGAACATGTCCCGCTTT

[0068] spoⅡQF2:AAAGCGGGACATGTTCAGCGAGGGATAATGCCAAGCACGGTAA

[0069] spoⅡQR2:CAGTATTGACTGCAGGCGGCCGCAAGCTTGAACGGCTGCCTATT

[0070] The amplified product was detected by 1% agarose gel electrophoresis, and specific bands appeared at about 600bp and 1200bp, the results are shown in figure 1 (a), (b), (c).

[0071] The knockout pTOPO-Cmr was double digested with BamHI and NotI, purified according to the steps provided in the purification kit, and the fusion fragment was connected to the vector by ...

Embodiment 2

[0074] Embodiment 2 Construction of recombinant bacteria Bacillus licheniformis (B.licheniformis) DL-1ΔspoⅡQΔpcf, Bacillus licheniformis (B.licheniformis) DL-1Δpcf

[0075] Since the construction process and method of the recombinant B. licheniformis DL-1Δpcf and the recombinant B. licheniformis DL-1ΔspoⅡQΔpcf are the same, only the recombinant B. licheniformis DL-1ΔspoⅡQΔpcf is used as example to illustrate;

[0076] Using Bacillus licheniformis genomic DNA and pHT01 plasmid as templates, PCR amplified pcf and Cm r and the recombinant fragment pcf-Cm r , the nucleotide sequences of the primers used are as follows:

[0077] pcfF CGCGGATCCTGTATAAGCCCTATCAAGATG

[0078] pcfR TTACCGTGCTTGGCATTATCCCTCGCTGAACATGTCCCGCTTT

[0079] cm r F CTACTGTTCAAACCAATGTGAAACTTTTGCTGGCCTTTTGCTCAC

[0080] cm r R CGCGGATCCTAGTGACTGGCGATGCTGTCGG

[0081] The amplified products were detected by 1% agarose gel electrophoresis, and specific bands appeared at around 600bp, 1200bp, and 1600bp, r...

Embodiment 3

[0083] Example 3 Determination of spore formation rate and enzyme activity of the starting bacterium and the recombinant bacterium (B.licheniformis) DL-1ΔspoⅡQ

[0084] Take out the bacterial solution of Bacillus licheniformis (B.licheniformis) DL-1 and recombinant bacteria (B.licheniformis) DL-1ΔspoⅡQ from the inoculation loop glycerol tube and streak on the LB plate, culture at 37°C for 24 hours, pick the plate The single colony above was inoculated into 50mL liquid LB medium, cultured at 37°C and 200rpm for 20h and subcultured twice; take the second-generation activated bacterial solution and transfer the starting strain and recombinant bacteria to 100mL liquid LB culture at an inoculation amount of 2%. base, 37°C, 200rpm shake flask culture for 36h, take out 2mL of bacteria and recombinant bacteria, heat treatment in 80°C water bath for 15min, apply LB solid medium after gradient dilution, culture at 37°C for 20h, plate colony count, according to The formula spore formatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method and an application for improving fermentation enzyme production of bacillus licheniformis by knocking out spoIIQ and pcf genes. Recombinant (B. licheniformis) DL-1 delta spoIIQ delta pcf is acquired by knocking out the spoIIQ and pcf genes, spore forming rate is reduced to 0.16%, and recombinant bacterium alpha-amylase activity is improved by 10.9% in flask shaking fermentation culture and improved by 19.3% in 5L fermentation culture. According to the method, fermentation activity of target enzymes of the bacillus licheniformis is improved to some extent, strain fermentation production performances are improved, and ideals and method reference can be provided for genetic engineering breeding of industrial microorganisms.

Description

technical field [0001] The invention relates to a method and application for knocking out spoIIQ and pcf genes to improve fermentation enzyme production of Bacillus licheniformis, belonging to the technical field of genetic engineering. Background technique [0002] Bacillus is an important fermentation production strain in the enzyme preparation industry. Bacillus licheniformis (Bacillus licheniformis) has a strong metabolism, rich enzyme system, and can produce α-amylase by large-scale fermentation. It is widely used in textile, food, feed, pharmaceutical and other industries . [0003] During the fermentation and enzyme production process of Bacillus, especially after the bacterial growth reaches the stable stage, due to the change of nutritional conditions and environmental conditions, the bacterial cells begin to form spores. The formation of spores is not conducive to high-density continuous fermentation, and will affect the control of the fermentation process, such a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/90C12N9/28C12R1/10
CPCC07K14/32C12N9/2417C12N15/902C12N9/242C12N15/67C12N15/75C12N2511/00C12Y302/01001
Inventor肖静张虎李子源
OwnerQILU UNIV OF TECH