Low-toxic herpes simplex virus system and construction method and application thereof
A herpes simplex virus and vector technology, applied in applications, viruses, viral peptides, etc., can solve the problems of inability to carry out neural circuit structure tracing, not to mention functional circuit analysis, low sensitivity, etc. The effect of good shape and wide range of infected hosts
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Construction of low-virulence herpes simplex virus recombinant targeting vector
[0054] (1) Homology arm cloning
[0055] The complete genome sequence of HSV-1H129 (GenBank: GU734772.1) was queried in the NCBI GenBank database, and the neurovirulence gene γ34.5 and its flanking DNA sequences were analyzed. There are two copies of the γ34.5 gene in the HSV genome, which are respectively located in the terminal repeat sequence TRL and IRL of the UL long fragment. The full length of the gene is 1007bp, the sequence is shown in SEQ ID NO.2, and the GC content is as high as 80%; double copies The γ34.5 gene is transcribed in the opposite direction, see figure 1 Indicated by the arrow in B; the present invention designs and knocks out the full-length gene (1007bp) of γ34.5, extracts and purifies HSV-1H129 virus genomic DNA, uses it as a template, and designs primers to clone the upstream homology arm of the γ34.5 gene (UHA, long 527bp, GC content 80%), the primer sequence ...
Embodiment 2
[0064] Low-virulence herpes simplex virus recombination, spot-picking purification and amplification preparation
[0065] ① Virus recombination: extract targeting vectors pH129Δγ34.5-hUbC-tdTomato-WPRE and pH129Δγ34.5-hUbC-EGFP-WPRE-PA, transfect 293T cells by liposome transfection, and replace after 6 hours The maintenance medium containing 2% FBS was added to the herpes simplex virus H129 strain for infection; the expression of fluorescence and cell pathology were observed at different times, and the supernatant of the cell culture medium was collected after all the cells were pathologically damaged and placed in a -80°C refrigerator.
[0066] ②Purification of the virus: The collected virus supernatant was frozen and thawed three times, centrifuged at 6500g for 10 minutes to remove cell debris, and 10 μl of the virus supernatant was taken to infect Vero cells. After 1 day, the infected cells were observed for fluorescent expression to determine whether the new virus was recom...
Embodiment 3
[0068] Molecular identification of low-virulence herpes simplex virus genome
[0069]The concentrated and purified wild-type H129 and low-virulence HSVLT (H129Δγ34.5-hUbC-tdTomato-WPRE) viruses were inactivated at 100°C for 10 minutes, and subsequently used for molecular identification of the γ34.5 gene. γ34.5 726bp ORF fragment was selected to design primers, and the primers and sequences used for identification were γ34.5-F: 5'ATGGCCCGCCGCCGCCGCCGCCATCGCGGCCCCCGCCGCCCCCGG 3'(SEQ ID NO.18); γ34.5-R: 5'TTAGACCGAGTTCGCCGGGCCGGCTCCGCGGGCCAGGGCCCGGGC 3'(SEQ ID .19). Since the GC content of the γ34.5 gene is as high as 82%, the high GC buffer system is used to amplify the γ34.5 ORF: the PCR reaction system is 50ul, and the amount of inactivated HSV virus sample is 1-5μl, 2×PrimeStar high-GC buffer 25μl, 20μM 0.7 μl each of primer 1 and primer 2, 5 μl of dNTPs, 0.6 μl of Primestar HS high-fidelity enzyme, and 50 μl of sterilized water. The PCR amplification conditions were: 98°C ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



