Low-toxic herpes simplex virus system and construction method and application thereof

A herpes simplex virus and vector technology, applied in applications, viruses, viral peptides, etc., can solve the problems of inability to carry out neural circuit structure tracing, not to mention functional circuit analysis, low sensitivity, etc. The effect of good shape and wide range of infected hosts

Pending Publication Date: 2019-08-13
WUHAN INST OF PHYSICS & MATHEMATICS CHINESE ACADEMY OF SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, HSV tool viruses generally have the defects of high toxicity and low sensitivity. H129 is a strain isolated from the brain of a patient with encephalitis. The wild strain has high toxicity, and the infected cells usually die quickly within two days; mice Generally, after brain infection with H129, it can only survive for 3-5 days, and it is impossible to carry out long-term neural circuit structure tracing, let alone functional circuit analysis. Therefore, it is very difficult to carry out research on attenuation and sensitization of HSV H129 Needed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Low-toxic herpes simplex virus system and construction method and application thereof
  • Low-toxic herpes simplex virus system and construction method and application thereof
  • Low-toxic herpes simplex virus system and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Construction of low-virulence herpes simplex virus recombinant targeting vector

[0054] (1) Homology arm cloning

[0055] The complete genome sequence of HSV-1H129 (GenBank: GU734772.1) was queried in the NCBI GenBank database, and the neurovirulence gene γ34.5 and its flanking DNA sequences were analyzed. There are two copies of the γ34.5 gene in the HSV genome, which are respectively located in the terminal repeat sequence TRL and IRL of the UL long fragment. The full length of the gene is 1007bp, the sequence is shown in SEQ ID NO.2, and the GC content is as high as 80%; double copies The γ34.5 gene is transcribed in the opposite direction, see figure 1 Indicated by the arrow in B; the present invention designs and knocks out the full-length gene (1007bp) of γ34.5, extracts and purifies HSV-1H129 virus genomic DNA, uses it as a template, and designs primers to clone the upstream homology arm of the γ34.5 gene (UHA, long 527bp, GC content 80%), the primer sequence ...

Embodiment 2

[0064] Low-virulence herpes simplex virus recombination, spot-picking purification and amplification preparation

[0065] ① Virus recombination: extract targeting vectors pH129Δγ34.5-hUbC-tdTomato-WPRE and pH129Δγ34.5-hUbC-EGFP-WPRE-PA, transfect 293T cells by liposome transfection, and replace after 6 hours The maintenance medium containing 2% FBS was added to the herpes simplex virus H129 strain for infection; the expression of fluorescence and cell pathology were observed at different times, and the supernatant of the cell culture medium was collected after all the cells were pathologically damaged and placed in a -80°C refrigerator.

[0066] ②Purification of the virus: The collected virus supernatant was frozen and thawed three times, centrifuged at 6500g for 10 minutes to remove cell debris, and 10 μl of the virus supernatant was taken to infect Vero cells. After 1 day, the infected cells were observed for fluorescent expression to determine whether the new virus was recom...

Embodiment 3

[0068] Molecular identification of low-virulence herpes simplex virus genome

[0069]The concentrated and purified wild-type H129 and low-virulence HSVLT (H129Δγ34.5-hUbC-tdTomato-WPRE) viruses were inactivated at 100°C for 10 minutes, and subsequently used for molecular identification of the γ34.5 gene. γ34.5 726bp ORF fragment was selected to design primers, and the primers and sequences used for identification were γ34.5-F: 5'ATGGCCCGCCGCCGCCGCCGCCATCGCGGCCCCCGCCGCCCCCGG 3'(SEQ ID NO.18); γ34.5-R: 5'TTAGACCGAGTTCGCCGGGCCGGCTCCGCGGGCCAGGGCCCGGGC 3'(SEQ ID .19). Since the GC content of the γ34.5 gene is as high as 82%, the high GC buffer system is used to amplify the γ34.5 ORF: the PCR reaction system is 50ul, and the amount of inactivated HSV virus sample is 1-5μl, 2×PrimeStar high-GC buffer 25μl, 20μM 0.7 μl each of primer 1 and primer 2, 5 μl of dNTPs, 0.6 μl of Primestar HS high-fidelity enzyme, and 50 μl of sterilized water. The PCR amplification conditions were: 98°C ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant low-toxic herpes simplex virus system derived from a herpes simplex virustype I H129 clinical toxic strain and a construction method and application thereof. A recombinant virus constructed by a target vector is a remarkably attenuated H129 recombinant virus, the abundance of exogenous gene expression is very high, the characteristics of low toxicity and long-term high expression are shown in in vitro test or animal in vivo test, center infected animals cannot cause diseases, many neurons in brain regions are highlighted, and neuron cell bodies, axonal / dendritic fiber, dendritic spines and other fine structures are marked clearly. The low-toxic herpes simplex virus is suitable for serving as a target gene long-term and high-expression gene transductionvector and achieving long-term structure tracing of a neural circuit, and due to low toxicity, the low-toxic herpes simplex virus is also suitable for functional neural circuit analysis; in addition,the low-toxic HSV has wide application value in the aspects of nervous system targeted gene therapy, virus replication and pathogenesis analysis, animal infection model establishment, antiviral drugscreening, oncolytic therapy and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, relates to neurobiology and virology, and specifically relates to a low-toxic herpes simplex virus tracer system and its construction method and application. The recombinant herpes simplex virus constructed by using the targeting vector provided by the invention can be used in neural circuits Labeling, gene transduction, oncolytic therapy, establishment of animal infection models, analysis of virus replication and pathogenic mechanism, screening of antiviral drugs, etc. Background technique [0002] Viral transsynaptic tracing techniques have been increasingly used in the dissection of neural circuits in recent years. Traditional neural network tracing methods, such as dyes, compound tracers, protein peptides, etc., can be transported along the axon, but because they cannot cross the synapse, they can only mark the local neuron morphology. Compared with neurotropic virus as a tracer tool, it has obv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/869
CPCC12N7/00C12N15/86C07K14/005C12N2710/16621C12N2710/16622C12N2710/16645
Inventor王华东徐富强苏鹏夏金金胡亮李颖利钟鑫
OwnerWUHAN INST OF PHYSICS & MATHEMATICS CHINESE ACADEMY OF SCI