Application of insect detoxification enzyme protein for degrading organophosphorus pesticide

A technology for detoxifying enzymes and pesticides, applied in the application field of insect glutathione-S transferase protein in the degradation of malathion, can solve the problem of unable to solve the problem of removing malathion pesticide residues

Active Publication Date: 2019-08-20
SHANXI UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the enzyme does not degrade malathion, so it cannot solve the problem of removing malathion pesticide residues, so other methods need to be found.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of insect detoxification enzyme protein for degrading organophosphorus pesticide
  • Application of insect detoxification enzyme protein for degrading organophosphorus pesticide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] Example 1: Obtaining the locust LmGSTpcF1 gene

[0012] Using the resistant strain locust cDNA as the template, the primers: FF 5'-3': ATGCCAGTCACCCTC, and FR 5'-3': CTACGGAGCCAGATG were cloned to obtain the full-length gene of LmGSTpcF1. The system is: 2 × Taq PCR MasterMix (25 μL), DNA template (1 μL), primers (1 μL each), ddH 2 O (21 μL) for a total of 50 μL. After recovery, purification and sequencing of the product, SEQ ID NO: 1 was obtained.

Embodiment 2

[0013] Example 2: Expression and purification of LmGSTpcF1

[0014] According to SEQ ID NO: 1, primers containing BamHI and HindIII restriction sites were designed, WF5'-3': TAGGATCCATGCCAGTCACCCTC and WR5'-3': ATAAGCTTCTACGGAGCCAGATG for recombinant plasmid construction. After PCR, the product was digested with BamHI and HindIII, and recovered by 1.5% agarose gel electrophoresis. The prokaryotic expression vector pET28a was also processed simultaneously. After mixing the recovered products, buffer and T4 ligase were added, ligated overnight at 4°C, and transformed into E. coli DH5α competent cells. The strains with accurate verification results were selected, expanded and cultured, the recombinant plasmids were extracted, and transformed into E. coli BL21(DE3) competent cells. Pick positive colonies, and expand the culture after PCR verification. The positive monoclonal colonies were inoculated into liquid LB medium (containing 50 μg·mL -1 kanamycin) in a test tube, cultu...

Embodiment 3

[0016] Example 3 Metabolism detection of malathion by LmGSTpcF1

[0017] The extent of malathion metabolism by LmGSTpcF1 was calculated using the peak area of ​​the pesticide detected by HPLC. The chromatographic detection conditions were that mobile phase A was acetonitrile, and B was 0.1% formic acid water. The elution gradient was A:B=80:20 isocratic elution for 8min; detection wavelength 210nm; column temperature 35℃; sample volume 2uL; flow rate 0.2mL / min.

[0018] The samples were divided into two groups, A and B. Group A was a normal reaction group (LmGSTpcF1+GSH+malathion); group B was a protein-free control group (PBS+GSH+malathion) with PBS buffer instead of protein. The 200uL reaction solution includes: 20uL 1.6mg / mL mGSTpcF protein (32ug); 15uL 20mg / mL malathion (300ug), 10uL 50mM GSH (2.5mM), PBS to make up the volume to 200uL. After the reaction solution was mixed, it was placed at 27°C, 1 200 r / min, and incubated for 3 h; after the reaction, 400 μL of acetoni...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to an application of an insect detoxification enzyme in pesticide degradation, in particular relates to an application of a detoxification enzyme LmGSTpcF1 in locusta migratoriafor degrading malathion pesticide, The detoxification enzyme LmGSTpcF1 in locusta migratoria has amino acid sequence as shown in SEQ ID NO: 2. After incubating LmGSTpcF1 and GSH with malathion under reaction conditions, the malathion is detected by liquid chromatography and the result show that the malathion is completely degraded substantially and no pesticide residues is detected and the degradation efficiency is more than 99%. The detoxification enzyme LmGSTpcF1 in locusta migratoria can be used to remove malathion pesticide residues in agricultural products, water sources, soils, etc.

Description

technical field [0001] The invention relates to the application of insect detoxification enzymes in pesticide degradation, in particular to the application of insect glutathione-S transferase protein in malathion degradation. Background technique [0002] In my country, malathion is widely used in pest control due to its high efficiency, low toxicity and broad-spectrum insecticidal properties. Since the target of malathion is acetylcholinesterase (AChE), it can affect the nervous system of mammals and humans, thereby causing harm. Long-term unreasonable excessive use of malathion not only greatly increases its pesticide residues in the environment, but also leads to insecticide resistance in insects, which further leads to the widespread use of pesticides. If things go on like this, malathion pesticide residues in the environment will affect food safety and people's health, and they need to be treated harmlessly. [0003] How to remove pesticide residues in a green and eff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54A62D3/02A62D101/04A62D101/28
CPCC12N9/1088A62D3/02C12Y205/01018A62D2101/04A62D2101/28Y02A50/30
Inventor张建琴马雯乔玉琪秦雪梅
OwnerSHANXI UNIV