Unlock instant, AI-driven research and patent intelligence for your innovation.

Nanoliposome-microbubble conjugate having cas9 protein, guide RNA for inhibiting expression of srd5a2 gene and cationic polymer complex encapsulated therein, and hair loss relieving or treating composition containing same

A cationic polymer, nano-liposome technology, applied in gene therapy, DNA/RNA fragments, nano-drugs, etc., can solve problems such as unfavorable drugs, delivery, etc., and achieve the effect of excellent biocompatibility

Active Publication Date: 2019-11-12
MOOGENE MEDI CO LTD
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this nanoliposome technology alone is not conducive to drug delivery into the dermis which exists below the stratum corneum which acts as a skin barrier (Nemes Z et al., 1999)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nanoliposome-microbubble conjugate having cas9 protein, guide RNA for inhibiting expression of srd5a2 gene and cationic polymer complex encapsulated therein, and hair loss relieving or treating composition containing same
  • Nanoliposome-microbubble conjugate having cas9 protein, guide RNA for inhibiting expression of srd5a2 gene and cationic polymer complex encapsulated therein, and hair loss relieving or treating composition containing same
  • Nanoliposome-microbubble conjugate having cas9 protein, guide RNA for inhibiting expression of srd5a2 gene and cationic polymer complex encapsulated therein, and hair loss relieving or treating composition containing same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0135]

Embodiment 1-1

[0136] Example 1-1. Preparation of guide RNA targeting SRD5A2 gene

[0137] Guide RNA targeting KRAS gene was prepared by in vitro transcription method using T7 RNA polymerase (NEB). For this purpose, a 140b.p. DNA template was prepared by the PCR method using the T7 promoter sequence and SEQ.ID.NO: 6: GTGTACTCACTGCTCAATCG, SEQ.ID.NO: 7: AGGGGCCGAACGCTTGTAAT, SEQ.ID.NO: 7: AGGGGCCGAACGCTTGTAAT, SEQ. .ID.NO: 8: ACTATATATTGCGCCAGCTC, SEQ.ID.NO: 9: CACAGACATACGGTTTAGCT, SEQ.ID.NO: 10: TCCATTCAATGATCTCACCG, SEQ.ID.NO: 21: ACAGACATGCGGTTTAGCGT, SEQ.ID.NO: 22: CGCGCAATAAACCAGGTAAT, SEQ .ID.NO: 23: TCCATTCAATAATCTCGCCC, SEQ.ID.NO: 24: TCCTGGGCGAGATTATTGAA, SEQ.ID.NO: 25: AGCCCGGAGAGGTCATCTAC (corresponding to the '69-mer forward primer' of the 20b.p. sequence of the SRD5A2 gene), A '20-mer reverse primer' containing a scaffold sequence that binds the guide RNA and a plasmid Cas guide vector (Origene). The DNA template, rNTP mixture, T7 RNA polymerase, and RNase inhibitor were subje...

Embodiment 1-2

[0151] Example 1-2. Purification of Cas9 protein

[0152] The pET28a / Cas9-Cys plasmid (Addgene plasmid #53261) was transformed into Escherichia coli (DH5α) and incubated at 28°C in 0.5mM IPTG (isopropyl β-D-1-thiogalactopyranoside) Escherichia coli overexpressing the Cas9 protein in lysis buffer (20 mM Tris-Cl pH 8.0, 300 mM NaCl, 20 mM imidazole, 1× protease inhibitor cocktail, 1 mg / mL lysozyme) sonicated in E. coli overexpressing the Cas9-protein. The lysate obtained after sonication was centrifuged to obtain a protein-containing liquid. Cas9 protein was isolated from liquid using Ni-NTA agarose bead extraction method (elution buffer: 20 mM Tris-Cl pH 8.0, 300 mM NaCl, 300 mM imidazole, 1× protease inhibitor cocktail). Proteins thus isolated were dialyzed against storage buffer (50 mM Tris-HCl pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol) (10K cut-off) to remove imidazoles and quantify the proteins Concentration (using the BCA method).

[0153] **S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
particle sizeaaaaaaaaaa
sizeaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a nanoliposome-microbubble conjugate having a Cas9 protein, a guide RNA for inhibiting the expression of an SRD5A2 gene and a cationic polymer complex encapsulated therein, and a hair loss relieving or treating composition containing same. A drug which is currently used as a hair loss therapeutic agent has disadvantages of severe side effects such as hyposexualityand erectile dysfunction and recurrence of hair loss in case of cessation of the drug treatment. However, by means of using the nanoliposome-microbubble conjugate of the present invention, SRD5A2, which induces hair loss, can substantially be inhibited and male pattern hair loss can effectively be treated.

Description

technical field [0001] The present invention relates to a nanoliposome-microvesicle conjugate, wherein a complex of CAS9 protein, a guide RNA for suppressing SRD5A2 gene expression, and a cationic polymer is encapsulated in a nanoliposome, and relates to a method for improving or treating hair loss A composition comprising the nanoliposome-microvesicle conjugate. [0002] More specifically, the present invention relates to a nanoliposome-microvesicle conjugate configured such that there is a nanolipid of a complex of a Cas9 protein, a guide RNA that inhibits the expression of the SRD5A2 gene, and a cationic polymer encapsulated therein A nanosome is chemically and stably conjugated to a microbubble having a hydrophobic gas therein, and a composition comprising the nanoliposome-microbubble conjugate for improving or treating hair loss. Background technique [0003] Gene editing technology originated from the adaptive immunity of microorganisms, which initially focused on the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K47/69A61K48/00A61K9/00
CPCA61K9/0009A61K48/00B82Y5/00A61K8/14A61K8/64A61K8/606A61K2800/782A61K2800/413A61Q7/00A61K2800/5426A61K47/6913A61K47/6925C12N9/22C12N15/11C12N2310/20
Inventor 柳智然元恩廷李汉润柳京南
Owner MOOGENE MEDI CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com