Unlock instant, AI-driven research and patent intelligence for your innovation.

Engineering bacterium for high yielding of salidroside and/or tyrosol and application of engineering bacterium

A technology of salidroside and engineering bacteria, applied in the field of bioengineering, can solve the problems of increasing difficulty and cost, increasing production cost, etc.

Active Publication Date: 2019-11-26
成都薇合生物科技有限公司
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] Although the production of salidroside in the subsequent recombinant large intestine was increased to a concentration of 0.7g / L, the low concentration undoubtedly increased the difficulty and cost of later extraction; two kinds of large intestine with glucose and xylose as substrates Bacillus co-cultivation technology, although 6.03g / L salidroside can be obtained, using more expensive xylose as substrate, also increases the production cost; although by optimizing the synthetic pathway of Saccharomyces cerevisiae, it will use cheap glucose as substrate Synthetic salidroside production increased to 1-1.1g / L, but for industrial production, there is still a demand for optimization and improvement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium for high yielding of salidroside and/or tyrosol and application of engineering bacterium
  • Engineering bacterium for high yielding of salidroside and/or tyrosol and application of engineering bacterium
  • Engineering bacterium for high yielding of salidroside and/or tyrosol and application of engineering bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] Embodiment 1, the construction of engineering bacteria of the present invention

[0096] 1. Construction method of engineering bacteria

[0097] (1) Starting from the original Saccharomyces cerevisiae strain HY001 (CEN.PK-1C), the three ARO genes in the main metabolic pathway were mutated sequentially, and the mutation method was the genome site-directed mutation technology mediated by CRISPR-Cas9:

[0098] The method of gene site-directed mutation, the plasmid used carries the gene of Cas9 protein and a gene for transcription, the transcribed RNA is combined with the Cas9 protein, and only a gene spacer and homologous recombination paired with the target gene need to be introduced on the plasmid Fragment, introduce the reconstructed plasmid into the cell, because the designed homologous recombination fragment is a site-directed mutation, the target gene cut off in the yeast eukaryotic cell, in the way of homologous recombination, using the homologous arm on the plasmid...

Embodiment 2

[0183] Example 2 Salidroside was prepared by fermenting engineering bacteria of the present invention

[0184] Get the salidroside high-yield strain HY007 prepared in Example 1, prepare salidroside according to the following method:

[0185] 1. Fermentation method:

[0186] (1) Take 1ml of the above bacterial solution cultured overnight (about 1×10 in each 1ml bacterial solution) 9 live cells) were inoculated into 50ml SC liquid medium, OD600=0.2 after inoculation, 30°C, 200rpm shaker culture for 24 hours, to obtain Saccharomyces cerevisiae seed liquid;

[0187] (2) Inoculate 50ml of Saccharomyces cerevisiae seed liquid obtained in step 1 into a 5L fermenter containing 2.5L SC medium, after inoculation, initial OD600=0.2, fermentation temperature 30°C, agitation speed 200-300rpm, control pH= 5.5 (adjusted by automatically adding 5M ammonia water), the air flow rate was 4L / min, and 500g / L glucose solution was continuously added to keep the glucose concentration in the ferment...

Embodiment 3

[0194] (1) On the HY004 strain, the mutated ARO4, ARO7, and ARO3 expression fragments were amplified and concatenated (ARO4p-ARO4-ARO4t-ARO7p-ARO7-ARO7t-ARO3p-ARO3-ARO3t), and the concatenated fragments were recombined into yeast The 308a position of the genome, thus obtaining the strain HY008.

[0195] (2) In Saccharomyces cerevisiae strain HY008, pHA2 was knocked out, pdc1 reduced the competition pathway between tryptophan and phenylalanine, and strain HY009 (CEN.PK-1C-mutARO4-mutARO7-mutARO3-ΔpHA2-Δpdc1) was obtained. The mutation method is CRISPR-Cas9-mediated genome knockout.

[0196] PHA2

[0197] Spacer: GGGGGATAGAGGCTGCTGGG (as shown in SEQ ID No.16)

[0198] homology arm

[0199] HR-Left: AGGTACGTATTCCCCATCAAGCTGCATTACAACAATTTCAATCAACATCTGATGTTGAGTA (as shown in SEQ ID No.17)

[0200] HR-Right: AATGTTTTAACCAATTGGAGAACGACACTAGTATAGATTATTCAGTGGTACCGTTGG (as shown in SEQ ID No.18)

[0201] pdc1 knockout

[0202] spacer: AGTCACCGTTACCCCAAGGTG (as shown in SEQ ID No....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of bioengineering, in particular to an engineering bacterium for high yielding of salidroside and / or tyrosol and application of the engineering bacterium. The engineering bacterium for high yielding of the salidroside is recombinant yeast obtained by processing saccharomyces cerevisiae in such a way that a codon for coding an amino acid at a 229th site in an ARO4gene is mutated into a codon for coding leucine, a codon for coding glycine at a 141st site in an ARO7 gene is mutated into a codon for coding serine, and a codon for coding lysine at a 222nd site inan ARO3 gene is mutated into a codon for coding leucine. The invention further discloses fermentation for preparing the salidroside through the engineering bacterium. The engineering bacterium can produce the salidroside and / or the tyrosol at the high yield, and has high economic value and good industrial application prospects.

Description

[0001] This application claims the priority of the Chinese patent application submitted to the China Patent Office on September 25, 2018, the application number is 201811116170.0, and the invention title is "an engineering bacterium with high salidroside production and its application", the entire content of which is passed References are incorporated in this application. technical field [0002] The invention relates to the field of bioengineering, in particular to an engineering bacterium with high salidroside and / or tyrosol production and application thereof. Background technique [0003] Rhodiola is a rare wild plant that grows in the alpine and pollution-free areas. It is a traditional drug used by the Tibetan people in my country. It has a history of more than 1,000 years of application. It has the functions of stimulating the nervous system, increasing work efficiency, eliminating fatigue and preventing altitude sickness. , It also has the functions of protecting cardi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12P19/44C12R1/865
CPCC12N1/18C12P19/44C07K14/395
Inventor 罗云孜刘化一贾佳曹凤
Owner 成都薇合生物科技有限公司