Engineering bacterium for high yielding of salidroside and/or tyrosol and application of engineering bacterium
A technology of salidroside and engineering bacteria, applied in the field of bioengineering, can solve the problems of increasing difficulty and cost, increasing production cost, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0095] Embodiment 1, the construction of engineering bacteria of the present invention
[0096] 1. Construction method of engineering bacteria
[0097] (1) Starting from the original Saccharomyces cerevisiae strain HY001 (CEN.PK-1C), the three ARO genes in the main metabolic pathway were mutated sequentially, and the mutation method was the genome site-directed mutation technology mediated by CRISPR-Cas9:
[0098] The method of gene site-directed mutation, the plasmid used carries the gene of Cas9 protein and a gene for transcription, the transcribed RNA is combined with the Cas9 protein, and only a gene spacer and homologous recombination paired with the target gene need to be introduced on the plasmid Fragment, introduce the reconstructed plasmid into the cell, because the designed homologous recombination fragment is a site-directed mutation, the target gene cut off in the yeast eukaryotic cell, in the way of homologous recombination, using the homologous arm on the plasmid...
Embodiment 2
[0183] Example 2 Salidroside was prepared by fermenting engineering bacteria of the present invention
[0184] Get the salidroside high-yield strain HY007 prepared in Example 1, prepare salidroside according to the following method:
[0185] 1. Fermentation method:
[0186] (1) Take 1ml of the above bacterial solution cultured overnight (about 1×10 in each 1ml bacterial solution) 9 live cells) were inoculated into 50ml SC liquid medium, OD600=0.2 after inoculation, 30°C, 200rpm shaker culture for 24 hours, to obtain Saccharomyces cerevisiae seed liquid;
[0187] (2) Inoculate 50ml of Saccharomyces cerevisiae seed liquid obtained in step 1 into a 5L fermenter containing 2.5L SC medium, after inoculation, initial OD600=0.2, fermentation temperature 30°C, agitation speed 200-300rpm, control pH= 5.5 (adjusted by automatically adding 5M ammonia water), the air flow rate was 4L / min, and 500g / L glucose solution was continuously added to keep the glucose concentration in the ferment...
Embodiment 3
[0194] (1) On the HY004 strain, the mutated ARO4, ARO7, and ARO3 expression fragments were amplified and concatenated (ARO4p-ARO4-ARO4t-ARO7p-ARO7-ARO7t-ARO3p-ARO3-ARO3t), and the concatenated fragments were recombined into yeast The 308a position of the genome, thus obtaining the strain HY008.
[0195] (2) In Saccharomyces cerevisiae strain HY008, pHA2 was knocked out, pdc1 reduced the competition pathway between tryptophan and phenylalanine, and strain HY009 (CEN.PK-1C-mutARO4-mutARO7-mutARO3-ΔpHA2-Δpdc1) was obtained. The mutation method is CRISPR-Cas9-mediated genome knockout.
[0196] PHA2
[0197] Spacer: GGGGGATAGAGGCTGCTGGG (as shown in SEQ ID No.16)
[0198] homology arm
[0199] HR-Left: AGGTACGTATTCCCCATCAAGCTGCATTACAACAATTTCAATCAACATCTGATGTTGAGTA (as shown in SEQ ID No.17)
[0200] HR-Right: AATGTTTTAACCAATTGGAGAACGACACTAGTATAGATTATTCAGTGGTACCGTTGG (as shown in SEQ ID No.18)
[0201] pdc1 knockout
[0202] spacer: AGTCACCGTTACCCCAAGGTG (as shown in SEQ ID No....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap