Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Probes, gene chip and kit for detecting folic acid gene polymorphism

A gene polymorphism and gene chip technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of large-scale deployment of expensive instruments in hospitals, complex nucleic acid extraction and purification steps, and long operating procedures. and other problems, to achieve the effect of reducing detection time and cost, high accuracy, fast and convenient accuracy

Pending Publication Date: 2019-12-27
ZHUHAI SINOCHIPS BIOSCIENCE CO LTD
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

One-generation sequencing is the gold standard for genetic testing, but its operation process is too long, the cost is too high, and the equipment is too expensive to be suitable for large-scale implementation in hospitals
[0009] However, the above-mentioned detection methods still face the following two problems: (1) complex nucleic acid extraction and purification steps are still required for saliva or blood samples; (2) accurate typing of multiple SNP sites cannot be achieved in one tube

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probes, gene chip and kit for detecting folic acid gene polymorphism
  • Probes, gene chip and kit for detecting folic acid gene polymorphism
  • Probes, gene chip and kit for detecting folic acid gene polymorphism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] A probe for detecting folic acid gene polymorphism, the sequence of the probe is:

[0066] MTHFR677-C probe: AAAAAAAAAACGTGATGATGAAATCGGCTC;

[0067] MTHFR677-T probe: AAAAAAAAAACGTGATGATGAAATCGACTC;

[0068] MTHFR1298-A probe: AAAAAAAAAACAAAGACACTTTTCTTCACTGGTC;

[0069] MTHFR1298-C probe: AAAAAAAAAAAAGACACTTGCTTCACTGGT;

[0070] MTRR66-A probe: AAAAAAAAAAACAGCTTGCTCACATATTTCTTC;

[0071] MTRR66-G probe: AAAAAAAAAAACACAGCTTGCTTGCTCACACA.

[0072] A gene chip containing the above-mentioned probes for detecting folic acid gene polymorphism, its preparation process comprises the following steps:

[0073] A silicon nitride film with a thickness of 47.5nm and a TSPS film of 13.5nm was coated on a silicon wafer (Si) with a thickness of about 2.5mm and a diameter of 20cm by a rotary vacuum coating machine and a vacuum vapor deposition method to prepare a corresponding biosensor , and covered with a 15nm polyphenylalanine-lysine coating, and finally treated with 10 μmol / L...

Embodiment 2

[0079] A kit for detecting folic acid gene polymorphism, comprising the gene chip in Example 1, PCR reaction system, hybridization buffer, washing solution, BW reaction solution and TMB chromogenic solution.

[0080] Wherein the composition of PCR reaction system is as shown in table 2:

[0081] Table 2: Composition of PCR reaction system

[0082]

[0083]

[0084] Wherein the sequence of the F-primer in the PCR reaction system is:

[0085] MTHFR677-F: 5'-TTGAGGCTGACCTGAAGCACTTGAAGGAG-3';

[0086] MTHFR1298-F: 5'-CTTTGGGGAGCTGAAGGACTA-3';

[0087] MTRR66-FP: 5'-CCTTGAAGTGATGAGGAGG-3'.

[0088] Wherein the sequence of the R-primer in the PCR reaction system is:

[0089] MTHFR677-R: 5'-CCTGGATGGGAAAGATCCCG-3';

[0090] MTHFR1298-R: 5'-CACTTTGTGACCATTCCGGTTT-3';

[0091] MTRR66-RP: 5'-CCACTGTAACGGCTCTAACC-3'.

[0092] The hybridization buffer includes 0.3 mol / L trisodium citrate, 3 mol / L sodium chloride, 0.3 mol / L sodium dodecyl sulfate and Triton X-100 0.1% aqueous ...

Embodiment 3

[0097] The gene chips and kits prepared in Example 1-2 were used for detection. The substance to be detected was a plasmid containing the target gene fragment. The above plasmids were all synthesized and provided by Shanghai Sangon Bioengineering Co., Ltd.

[0098] Wherein the target gene fragment includes one of the MTHFR677 (C / T) site, MTHFR1298 (A / C) site and MTRR66 (A / G) site, and the specific sequences of the target gene segment are as follows:

[0099] TTGAAGGAGAAGGTGTCTGCGGGAG[C / T]CGATTTCATCATCACGCAGCTTTTC;

[0100] TGGGGGGAGGAGCTGACCAGTGAAG[A / C]AAGTGTCTTTGAAGTCTTCGTTCTT;

[0101] AGGCAAAGGCCATCGCAGAAGAAAT[A / G]TGTGAGCAAGCTGTGGTACATGGAT.

[0102] The MTHFR677-C plasmid, the MTHFR1298-A plasmid and the MTRR66-A plasmid were mixed to obtain a mixed plasmid, and the mixed plasmid was dissolved in 1 mL of TE buffer so that the concentration of the plasmid was 2 μg / mL or 2000 ng / mL. Take 5 μL of the plasmid solution as the test substance and add it into the PCR reaction sys...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
diameteraaaaaaaaaa
thicknessaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biological detection, and discloses probes, a gene chip and a kit for detecting folic acid gene polymorphism. The probes include an MTHFR677-C probe, anMTHFR677-T probe, an MTHFR1298-A probe, an MTHFR1298-C probe, an MTRR66-A probe and an MTRR66-G probe. The gene chip contains the probes. The kit includes the probes and the gene chip. According to the probes, the gene chip and the kit, through selection of the specific probes and primers, a method of the gene chip is combined, and the advantages of good specificity, high accuracy and the rapidity and the convenience are achieved; through visible light optical enlargement of the gene chip, high signal resolution can be reached; meanwhile, one-time multi-site determination of folic acid genesis realized, the detection time is shortened, and the detection cost is reduced; and detection results can be directly read by picture taking or naked eyes, and the simpleness and the convenience areachieved.

Description

technical field [0001] The invention belongs to the technical field of biological detection, in particular to a probe, a gene chip and a kit for detecting folic acid gene polymorphism. Background technique [0002] Folic acid is a water-soluble B vitamin. As the most important one-carbon unit carrier in the body, its main physiological function is to participate in many cell metabolism processes in the body. Folic acid is essential in the metabolism of methionine and works in the form of 5-methyltetrahydrofolate. If folic acid is lacking, it will have adverse effects on the human body, especially to the development of pregnant women and fetuses. Folic acid can also have a certain effect on the gene expression of cancer cells, inhibit their growth, and have certain anti-cancer effects. [0003] Folic acid metabolism ability refers to the ability of folic acid to be absorbed and utilized by the human body, mainly refers to the mutual conversion process between homocysteine ​​...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6886C12Q1/6837C12N15/11
CPCC12Q1/6837C12Q1/6883C12Q1/6886C12Q2600/156
Inventor 肖杰王丽玲余义文陈建奇宋家武
Owner ZHUHAI SINOCHIPS BIOSCIENCE CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com