Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene SNP detection kit for determining the therapeutic effect of clopidogrel

A technology of clopidogrel and kits, applied in the field of genes, to achieve the effects of low false positive, high efficiency and high detection sensitivity

Active Publication Date: 2020-11-17
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to the search of existing literature, the P2Y12 gene is located on the human chromosome 3 q25.1 as the final binding receptor in the metabolic process of clopidogrel, that is, the drug target P2Y12 gene polymorphism, but it has not been found in the Chinese population before P2Y12rs16863356, rs7634096 and rs12497330 are relevant reports of clopidogrel pharmacodynamic molecular markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene SNP detection kit for determining the therapeutic effect of clopidogrel
  • Gene SNP detection kit for determining the therapeutic effect of clopidogrel

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Primer Design and Synthesis

[0038] Design corresponding specific PCR primer sequences (SEQ ID No: 1 to SEQ ID No: 6) and specific extensions for the three gene polymorphism sites related to clopidogrel medication at rs16863356, rs7634096 and rs12497330 of the P2Y12 gene Primer sequences (SEQ ID No: 7 to SEQ ID No: 9); details are shown in Table 2:

[0039] Table 2

[0040] Numbering target site sequence (5'-3') use SEQ ID No: 1 rs7634096 ACGTTGGATGTAAAATAGGTCCTCAGACCC PCR forward primer SEQ ID No: 2 rs16863356 ACGTTGGATGTGAGTCTTAGCAACTGAAGG PCR forward primer SEQ ID No: 3 rs12497330 ACGTTGGATGCACTTTATATACATACCCTG PCR forward primer SEQ ID No: 4 rs7634096 ACGTTGGATGCATCCCTGTCTCTCACAAAG PCR reverse primer SEQ ID No: 5 rs16863356 ACGTTGGATGACAAGTGTGTCAGGAATACC PCR reverse primer SEQ ID No: 6 rs12497330 ACGTTGGATGCACAGTCAAAATGTAGACAC PCR reverse primer SEQ ID No: 7 rs7634096 A...

Embodiment 2

[0041] Embodiment 2, sample DNA extraction

[0042] 5 ml of blood drawn were collected in vacutainer tubes containing 3.2% trisodium citrate and lithium heparin and allowed to stand for at least 6 hours. Invert blood collection tubes 3-5 times to ensure thorough mixing of blood and anticoagulant. use The DNA MiniKit (250) kit was used for DNA extraction; the determination of the DNA concentration was completed on the Thermo Fisher NanoDrop 2000 ultra-micro-volume UV spectrophotometer; when performing sample determination, it was necessary to record the three values ​​of concentration, 260 / 280 and 260 / 230, In order to find the possible cause of contamination so that the concentration does not reach the requirement, it is also required that the experimenter must aliquot the DNA sample so that the number of times of freezing and thawing the sample can be reduced during the experiment to ensure the high quality of the DNA. Then dilute the extracted sample concentration with d...

Embodiment 3

[0043] Embodiment 3, biological experiment

[0044] Using ABI 9700 PCR instrument, according to the instruction manual, 3 gene polymorphisms related to the efficacy of clopidogrel were detected; the reagents involved are shown in Table 3:

[0045] table 3

[0046]

[0047]

[0048] 1. PCR reaction conditions: 95°C, 2min; 45 cycles (95°C, 30s; 56°C, 30s; 72°C, 60s); 72°C, 5min.

[0049] 2. SAP digestion reaction conditions: 37°C, 40min; 85°C, 5min.

[0050] 3. UEP extension reaction conditions: 94°C, 30s; 40 external cycles (94°C, 5s; 5 internal cycles (52°C, 5s; 80°C, 5s)); 72°C, 3min.

[0051] 4. Purification: Add 16 μL of deionized water to each tube of the extension product, put it into the MassARRAY kit resin until mixed evenly, and centrifuge.

[0052] 5. Spotting: Use a micropipette to spot 1 μL of the purified product onto the target slice.

[0053] 6. On-machine detection: Clean the 24 needles of the sample pointing robot arm with NaOH; sample point; mass spe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP detection kit for determining a gene related to the drug use curative effect of clopidogrel. The detection kit comprises an MassARRAY chip and three primers, namely theforward primer, the reverse primer and the extension primer, at three SNP sites, namely rs16863356, rs7634096 and rs12497330, of a detection gene P2Y12, the sequences of the primers are sequentially shown as SEQ ID No.1-9, and the primers are used for identifying the polymorphic sites of the gene related to the drug effect and the adverse reaction of the clopidogrel. The kit can conduct high-fluxdetection on the three sites and has the advantages of high sensitivity, high specificity, stable detection result, high reliability and the like; and meanwhile the kit is suitable for the gene analysis fields of clinical disease mutation detection, pharmacogenomics analysis, medicolegal expertise and the like.

Description

technical field [0001] The invention belongs to the field of gene technology, and relates to a detection kit for determining the gene polymorphism (SNP) related to the therapeutic effect of clopidogrel. Background technique [0002] The chemical name of Clopidogrel is (S)-α-(2-chlorophenyl)-6,7-dihydrothieno[3,2-C]pyridine-5(4H)-acetic acid methyl ester, molecular formula C 16 h 16 ClNO 2 S. Clopidogrel is a new and widely used drug of choice in the treatment of cardiovascular and cerebrovascular diseases, especially acute coronary syndrome and percutaneous coronary intervention. At the same time, as a thienopyridine antiplatelet drug, clopidogrel has certain structural characteristics and functions, and its clinical adverse events have certain advantages compared with other anticoagulants, so it is considered an important consideration in the treatment of cardiovascular and cerebrovascular diseases. antiplatelet drugs. In recent years, with in-depth research combined ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/106C12Q2600/118C12Q2600/156C12Q2531/113C12Q2533/101C12Q2565/627
Inventor 秦胜营张素丽朱金行张娜贺林
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products