Gene SNP detection kit for determining the therapeutic effect of clopidogrel
A technology of clopidogrel and kits, applied in the field of genes, to achieve the effects of low false positive, high efficiency and high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1: Primer Design and Synthesis
[0038] Design corresponding specific PCR primer sequences (SEQ ID No: 1 to SEQ ID No: 6) and specific extensions for the three gene polymorphism sites related to clopidogrel medication at rs16863356, rs7634096 and rs12497330 of the P2Y12 gene Primer sequences (SEQ ID No: 7 to SEQ ID No: 9); details are shown in Table 2:
[0039] Table 2
[0040] Numbering target site sequence (5'-3') use SEQ ID No: 1 rs7634096 ACGTTGGATGTAAAATAGGTCCTCAGACCC PCR forward primer SEQ ID No: 2 rs16863356 ACGTTGGATGTGAGTCTTAGCAACTGAAGG PCR forward primer SEQ ID No: 3 rs12497330 ACGTTGGATGCACTTTATATACATACCCTG PCR forward primer SEQ ID No: 4 rs7634096 ACGTTGGATGCATCCCTGTCTCTCACAAAG PCR reverse primer SEQ ID No: 5 rs16863356 ACGTTGGATGACAAGTGTGTCAGGAATACC PCR reverse primer SEQ ID No: 6 rs12497330 ACGTTGGATGCACAGTCAAAATGTAGACAC PCR reverse primer SEQ ID No: 7 rs7634096 A...
Embodiment 2
[0041] Embodiment 2, sample DNA extraction
[0042] 5 ml of blood drawn were collected in vacutainer tubes containing 3.2% trisodium citrate and lithium heparin and allowed to stand for at least 6 hours. Invert blood collection tubes 3-5 times to ensure thorough mixing of blood and anticoagulant. use The DNA MiniKit (250) kit was used for DNA extraction; the determination of the DNA concentration was completed on the Thermo Fisher NanoDrop 2000 ultra-micro-volume UV spectrophotometer; when performing sample determination, it was necessary to record the three values of concentration, 260 / 280 and 260 / 230, In order to find the possible cause of contamination so that the concentration does not reach the requirement, it is also required that the experimenter must aliquot the DNA sample so that the number of times of freezing and thawing the sample can be reduced during the experiment to ensure the high quality of the DNA. Then dilute the extracted sample concentration with d...
Embodiment 3
[0043] Embodiment 3, biological experiment
[0044] Using ABI 9700 PCR instrument, according to the instruction manual, 3 gene polymorphisms related to the efficacy of clopidogrel were detected; the reagents involved are shown in Table 3:
[0045] table 3
[0046]
[0047]
[0048] 1. PCR reaction conditions: 95°C, 2min; 45 cycles (95°C, 30s; 56°C, 30s; 72°C, 60s); 72°C, 5min.
[0049] 2. SAP digestion reaction conditions: 37°C, 40min; 85°C, 5min.
[0050] 3. UEP extension reaction conditions: 94°C, 30s; 40 external cycles (94°C, 5s; 5 internal cycles (52°C, 5s; 80°C, 5s)); 72°C, 3min.
[0051] 4. Purification: Add 16 μL of deionized water to each tube of the extension product, put it into the MassARRAY kit resin until mixed evenly, and centrifuge.
[0052] 5. Spotting: Use a micropipette to spot 1 μL of the purified product onto the target slice.
[0053] 6. On-machine detection: Clean the 24 needles of the sample pointing robot arm with NaOH; sample point; mass spe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


