Tetrahydropyridine high-yield Corynebacterium glutamicum and application thereof

A technology of Corynebacterium glutamicum and ectoine, applied in the field of bioengineering, can solve problems such as endotoxin and bacteriophage pollution, and achieve the effect of strengthening accumulation and increasing production

Active Publication Date: 2020-01-17
无锡晶扬生物科技有限公司
View PDF5 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved in the present invention is the endotoxin and bacteriophage contamination problems that exist when recombinant Escherichia coli is used to ferment and produce ectoine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tetrahydropyridine high-yield Corynebacterium glutamicum and application thereof
  • Tetrahydropyridine high-yield Corynebacterium glutamicum and application thereof
  • Tetrahydropyridine high-yield Corynebacterium glutamicum and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: Construction and transformation of recombinant Corynebacterium glutamicum ectoine high-yielding strain

[0045] (1) Construction of ectoine expression plasmid

[0046] Primers ect-PF and ect-PR were designed according to the ectopyrimidine synthesis gene cluster ectABC in Pseudomonas stutzeri (Pseudomonas stutzeri A1501), and the 5' end was amplified by PCR using the genomic DNA of Pseudomonas stutzeri A1501 as a template The ectABC gene with the artificially designed RBS (the nucleotide sequence of the ectABC gene with the artificially designed RBS is shown in SEQID NO.1, wherein 1 to 26bp is the artificially designed RBS), and an approximately 2.3kb Gene fragments and purification of PCR products.

[0047] Primers:

[0048] ect-PF: acagaattaattaagcttgtttaactttaagaaggagatataccatgcctaccctaaaaaggaattcaatcaac, SEQ ID NO. 2,

[0049] ect-PR: agctcggtacccggggatcctcagacggtttcggcctccagagga, SEQ ID NO.3.

[0050] Using the commercial expression plasmid pXMJ19...

Embodiment 2

[0092] Embodiment 2: Recombinant Corynebacterium glutamicum fermenter culture synthetic ectoine

[0093] The ectoine synthesis ability of the recombinant Corynebacterium glutamicum high-yielding strain CG-ECT3 was analyzed at the fermenter level by high-density culture.

[0094] Inoculate the seed liquid into a 2.5L fermenter with 1L fermenter medium at an inoculation amount of 10% (volume ratio), control the temperature at 30°C, and maintain the pH at 1vvm by adding 3M phosphoric acid and 3M ammonia water The value is stable at 6.8-7.2. Ferment for about 6 hours, OD 600 At 10 o'clock, add IPTG with a final concentration of 0.5mM; after 16 hours of fermentation, start feeding medium to maintain the glucose concentration in the range of 2-5g / L. The rotational speed was adjusted throughout the fermentation process so that the dissolved oxygen level remained above 10% (the dissolved oxygen before inoculation was calibrated as 100%).

[0095] Fermenter culture medium: every lit...

Embodiment 3

[0098] Embodiment 3: Recombinant Corynebacterium glutamicum fermenter culture synthetic ectoine

[0099] The ectoine synthesis ability of the recombinant Corynebacterium glutamicum high-yielding strain CG-ECT3 was analyzed at the fermenter level by high-density culture.

[0100] Inoculate the seed liquid into a 2.5L fermenter with 1L fermenter medium at an inoculation amount of 10% (volume ratio), control the temperature at 30°C, and maintain the pH at 1vvm by adding 3M phosphoric acid and 3M ammonia water The value is stable at 6.8-7.2. Ferment for about 6 hours, OD 600 At 10 o'clock, add IPTG with a final concentration of 0.5mM; after 16 hours of fermentation, start feeding medium to maintain the glucose concentration in the range of 2-5g / L. The rotational speed was adjusted throughout the fermentation process so that the dissolved oxygen level remained above 10% (the dissolved oxygen before inoculation was calibrated as 100%).

[0101] Fermenter medium: every liter of me...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Dry cell weightaaaaaaaaaa
Dry cell weightaaaaaaaaaa
Dry cell weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses tetrahydropyridine high-yield Corynebacterium glutamicum and application thereof and belongs to the field of bioengineering. Feedback inhibition is relieved through site-directed mutagenesis of Corynebacterium glutamicum aspartokinase gene lysC, and expression of mutational LysC is intensified through promoter replacement. Further, pentose phosphate pathway of host bacteriais further intensified through promoter replacement to meet needs on reducing power NADPH in efficient synthesis of tetrahydropyridine. Finally, tetrahydropyridine high-yield Corynebacterium glutamicum is obtained by transferring tetrahydropyridine synthetic gene cluster ectABC of P. stutzeri into recombinant bacteria. By recombinant Corynebacterium glutamicum, tetrahydropyridine can be efficiently synthesized by utilizing cheap raw materials like glucose and maize plasm; compared with recombinant Escherichia coli produced strains, tetrahydropyridine high-yield Corynebacterium glutamicum hasbetter bio-safety and is of great significance to industrial production and large-scale application of tetrahydropyridine.

Description

technical field [0001] The invention relates to a Corynebacterium glutamicum producing ectoine and its application, belonging to the field of bioengineering. Background technique [0002] The ectoine is a compatible solute that widely exists in salt-tolerant and halophilic microorganisms. As an osmotic pressure regulating substance, ectoine can stabilize proteins, nucleic acids, biofilms, and the entire cell, and can enhance cells in the environment. Tolerance in various stresses (such as high salt, heat, desiccation and freezing, etc.). Therefore, it shows important application value and wide application prospect in many fields such as medicine, beauty treatment and enzyme preparation. [0003] At present, ectoine is mainly fermented and produced by halophilic microorganisms through the "bacterial milking method". The intracellular accumulation and secretion of ectoine is achieved through high-salt-induced synthesis, low-salt release, and multiple cycles of osmotic pressur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/77C12N15/54C12P17/12C12R1/15
CPCC12N1/20C12N9/1217C12N15/77C12P17/12C12Y207/02004
Inventor董亮宁健飞
Owner无锡晶扬生物科技有限公司