Supercharge Your Innovation With Domain-Expert AI Agents!

Method for preparing laminaribiose through starch conversion

A technology of kelp disaccharide and catalytic preparation, applied in the direction of fermentation, can solve the problem of high cost of separation, and achieve the effects of improved conversion efficiency, high yield and high utilization rate of raw materials

Pending Publication Date: 2020-02-21
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Japanese scientists use 3 enzymes (sucrose phosphorylase, glucose isomerase and laminaribiose phosphorylase) to produce laminaribiose with sucrose as a substrate. However, the yield of laminaribiose is only about 50%, which leads to subsequent Higher cost of product separation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing laminaribiose through starch conversion
  • Method for preparing laminaribiose through starch conversion
  • Method for preparing laminaribiose through starch conversion

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 In vitro multi-enzyme catalysis converts starch into laminaribiose

[0048] Catalytic pathway for the conversion of starch to laminaribiose by a multi-enzyme catalytic system in vitro see figure 1 . The key enzymes and key steps involved include: (1) starch phosphorylase (αGP, EC 2.4.1.1), which is used to release glucose-1-phosphate from starch; (2) glucosidase (AG, EC 3.2 .1.20), used to release glucose from starch; (3) laminaribiose phosphorylase (LBP, EC 2.4.1.31), used to catalyze the formation of laminaribiose from glucose-1-phosphate and glucose.

[0049] In this embodiment, the starch phosphorylase is derived from Thermotoga maritima, whose gene number on KEGG is TM1168; the glucosidase is derived from Paecilomyces lilacinus, whose gene is listed on KEGG The number on KEGG is QAQ81244; laminaribiose phosphorylase is derived from Paenibacillus sp., and its gene number on KEGG is BAJ10826. These genomic DNAs are all available from the official website...

Embodiment 2

[0053] Example 2 Improve the yield of laminaribiose by adding enzymes that promote starch hydrolysis

[0054] Starch phosphorylase cannot completely hydrolyze starch, such as figure 1 It was shown that isoamylase can assist in the hydrolysis of starch, that is, adding isoamylase (IA, EC 3.2.1.68) that can help hydrolyze starch in the reaction system can increase the yield of laminaribiose.

[0055] In this example, the isoamylase is derived from Sulfolobus tokodaii, whose gene number on KEGG is ST0928, and the genomic DNA of this strain is purchased from DSMZ, the German Culture Collection. This gene was obtained from the corresponding genomic DNA by PCR with primers F4 / R4, wherein, F3: GTTTAACTTTAAGAAGGAGATATAATGGTTTTTTCACAAGGATAGACC, R: GTGGTGGTGGTGGTGGTGCTCGAGCTAATATTCAATCCCTATATACC, and cloned into the pET20b vector by the method of Simple Cloning to obtain the corresponding expression vector pET20b-StIA. Then, this plasmid was transformed into Escherichia coli expression...

Embodiment 3

[0060] Example 3 By optimizing the reaction system, the yield of laminaribiose is further improved

[0061] The preparation of isoamylase, starch phosphorylase, glucosidase and laminaribiose phosphorylase is the same as in Example 1.

[0062] The reaction system contains 5mM sodium acetate buffer solution (pH 5.5), 0.5mM divalent zinc ions, 5U / mL isoamylase, and 200g / L starch, and the catalytic reaction is carried out at 85°C for 3 hours.

[0063] After gradual optimization, it was determined that the optimum concentration of potassium phosphate was 20mM, the optimum amount of enzymes added was 2U / mL of starch phosphorylase, 1U / mL of glucosidase, and 3U / mL of laminaribiose phosphorylase, and then the reaction system contained 100mM HEPES buffer (pH6.5), 5mM divalent zinc ions, 20mM potassium phosphate (pH 6.5), 2U / mL starch phosphorylase, 1U / mL glucosidase, 3U / mL laminaribiose phosphorylase, 10g / L IA-treated starch was catalyzed at 50°C for 12 hours, and the detection of lami...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing laminaribiose through starch conversion by constructing an in-vitro multienzyme molecular machine through multienzyme cascading catalysis and belongs tothe field of enzyme catalysis preparation of laminaribiose. The method for preparing the laminaribiose, which is disclosed by the invention, comprises the following steps: respectively converting glucose units in starch through amylophosphorylase and glucosidase to generate glucose-1-phosphoric acid and glucose, and synthesizing the laminaribiose from the glucose-1-phosphoric acid and the glucosethrough laminaribiose phosphorylase. In the process, other auxiliary enzymes such as isoamylase for promoting complete phosphorus decomposition of the starch are added, so that the utilization rate ofthe starch can be further increased, and the final concentration of the laminaribiose can be increased. The technical method has the advantages that a substrate is low in price and easy to obtain, the production cost is low, the product yield is high, separation and purification are simple, and the like, and on-scale production of the laminaribiose can be achieved.

Description

technical field [0001] The invention belongs to the field of biomanufacturing, and in particular relates to a method for preparing laminaribiose by using starch as a raw material through an enzymatic method. Background technique [0002] Laminaribiose is an oligosaccharide linked by β-1,3 glycosidic bonds. It is mainly used in the agricultural field to promote seed germination and also as a natural preservative. [0003] At present, the production of kelp disaccharide is mainly the traditional dilute acid hydrolysis of pine needles or kelp and other polysaccharides. The process yield is low and the cost of separation and extraction is high, resulting in high prices of laminaribiose. Laminaribiose can also be prepared by a chemical method, that is, using a halogen glycosyl as a glycosyl donor, and obtaining laminaribiose through O-glycosylation derived from the Koenigs-Knorr method. However, the final product is not easy to purify, and the final yield is less than 10%. [...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/14C12P19/18C12P19/12
CPCC12P19/12C12P19/14C12P19/18
Inventor 游淳孙尚尚
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com