Novel phospholipase D and method for preparing functional phospholipids by using same

A phospholipase and mutant technology, applied in the direction of microorganism-based methods, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of long fermentation cycle and complicated culture conditions of Streptomyces

Active Publication Date: 2020-03-24
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF11 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the long fermentation period and complex culture conditions of Streptomyces, it is necessary to produce high-activity PLD by heterologous expression.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel phospholipase D and method for preparing functional phospholipids by using same
  • Novel phospholipase D and method for preparing functional phospholipids by using same
  • Novel phospholipase D and method for preparing functional phospholipids by using same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Embodiment 1: the acquisition of wild-type phospholipase D gene

[0063] 1. The wild-type phospholipase D gene comes from a strain of Streptomyces antibioticus, and its genomic DNA is extracted.

[0064] Wherein the extraction steps of antibiotic Streptomyces genomic DNA are as follows:

[0065] (1) Pick a ring of bacteria from the culture plate and inoculate in 50mL of appropriate medium, culture at 26°C, 150r / min for 2-3d.

[0066] (2) After that, take 1 mL of the culture solution in a 1.5 mL EP tube, centrifuge at 8000 r / min for 20 min, pour off the supernatant, and resuspend with 200 μL of solution I or sterilized water.

[0067] (3) Add 20-50μL of 50mg / mL lysozyme and digest at 37°C for 0.5-1h.

[0068] (4) Add 100 μL of 2% SDS solution and fully react until the bacterial suspension becomes viscous.

[0069] (5) Add an equal volume of Tris to balance phenol:chloroform=1:1, mix well, centrifuge at 12000r / min for 5min, and transfer the supernatant to another EP tu...

Embodiment 2

[0080] Embodiment 2: the screening of high activity phospholipase D gene

[0081] 1. Random mutation based on error-prone PCR technology to construct a new type of phospholipase D, and design primers as follows:

[0082] Upstream P1 (SEQ ID NO: 5): CCGGAATTCGGCGGACACACCGCC

[0083] Downstream P2 (SEQ ID NO: 6): AAGGAAAAAAGCGGCCGCGCCCGCCTGGCG

[0084] In the error-prone PCR reaction system, P1 and P2 were used as upstream and downstream primers, and pET22b-pld, the recombinant vector in which the wild-type phospholipase D gene was connected to the pET22b vector, was used as a template to perform error-prone PCR.

[0085] The reaction conditions for its amplification are:

[0086]

[0087]

[0088] Amplification conditions were: pre-denaturation at 95°C for 10 min; denaturation at 98°C for 10 s, annealing at 53°C for 30 s, extension at 72°C for 1 min and 45 s for 30 cycles; extension at 72°C for 10 min.

[0089] 2. Cloning the phospholipase D error-prone PCR product int...

Embodiment 3

[0102] Example 3: On the basis of a single amino acid mutation, a phospholipase D variant with multiple amino acid mutations is obtained. Taking the overlapping PCR technique as an example to carry out N153I, G270F, P316W, and A452F mutations on the basis of the pldmD84I mutant, the final gene sequence is as follows: Shown in SEQ ID NO:3, the final amino acid sequence is shown in SEQ ID NO:4.

[0103] The specific strategy is: first realize the double mutation on the basis of a single mutation, and then carry out the mutation of the third, fourth and fifth amino acids.

[0104] First realize the mutation of N153I on the basis of D84I, the steps are the same as in Example 2, and the overlapping primers are designed as follows:

[0105] Upstream P1 (SEQ ID NO.5): CCGGAATTCGGCGGACACACCGCC

[0106] Downstream P2 (SEQ ID NO. 6): AAGGAAAAAAGCGGCCGCGCCCGCCTGGCG

[0107] Overlapping primer P5 (SEQ ID NO.7): CGGCAAGGTCACGCTCATCGTCGCCTC

[0108] Overlapping primer P6 (SEQ ID NO.8): G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
purityaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of genetic engineering of enzymes, and specifically relates to a novel phospholipase D. The novel phospholipase D with improved specific enzyme activity isprepared through following steps: a phospholipase D mutant is obtained through error-prone PCR technology and overlapping PCR technology directed evolution in vitro; then expression of high-activityphospholipase D gene in a bacillus subtilis expression system, a bacillus amyloliquefaciens expression system and a bacillus licheniformis expression system is carried out respectively; and after expression, the specific enzyme activity of the high-activity phospholipase D is detected to be improved by 500% at most compared with that of wild phospholipase D. The highest fermentation enzyme activity values of the high-activity phospholipase D in the bacillus subtilis expression system, the bacillus licheniformis expression system and the bacillus amyloliquefaciens expression system are 319.1 U / mL, 952.2 U / mL and 1304.5 U / mL respectively; and phosphatidic acid, phosphatidylserine, phosphatidylethanolamine, phosphatidylglycerol and phosphatidylinositol can be effectively prepared by using thehigh-activity phospholipase D.

Description

Technical field: [0001] The invention belongs to the technical field of gene engineering of enzymes, and specifically relates to phospholipase D mutants with improved specific enzyme activity obtained by in vitro directed evolution through error-prone PCR technology and overlapping PCR technology, and provides a method for preparing functional phospholipids catalyzed by high-activity phospholipase D method. Background technique: [0002] Phospholipase D (phospholipase D, PLD) has a wide range of sources, mainly distributed in animals, plants and microorganisms. PLD can catalyze two reactions: first, hydrolyze phospholipids to generate phosphatidic acid and hydroxyl compounds; second, when another hydroxyl-containing compound exists, it can catalyze its binding to the base of phospholipids to form new phospholipids , which is the transphosphorylation reaction or base exchange reaction of PLD. The most important of the two reactions is the transphosphorylation of PLD, which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/16C12N15/55C12N15/75C12N1/21C12P9/00C12P19/44C12P13/06C12P13/00C12R1/125C12R1/07C12R1/10
CPCC12N9/16C12N15/75C12P7/6481C12P19/44C12P13/06C12P13/001C12Y301/04004
Inventor刘逸寒路福平王楠
OwnerTIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY