Construction and application of a recombinant Bacillus subtilis that secretes mthase and mtsase simultaneously

A technique for secreting signal peptides from Bacillus subtilis, which is applied in the fields of genetic engineering and fermentation engineering to achieve the effect of improving cascaded catalytic efficiency

Active Publication Date: 2021-12-21
QILU UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this study did not provide any information on the construction of recombinant Bacillus subtilis that uses the polypeptide pair spyCatcher / spyTag as a medium to construct synchronous secretion of MTHase ​​and MTSase and the formation of MTSase-MTHase ​​multi-enzyme complexes of different proportions and structures according to different assembly methods involved in the present invention. , improve the cascade catalytic efficiency of MTSase and MTHase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of a recombinant Bacillus subtilis that secretes mthase and mtsase simultaneously
  • Construction and application of a recombinant Bacillus subtilis that secretes mthase and mtsase simultaneously
  • Construction and application of a recombinant Bacillus subtilis that secretes mthase and mtsase simultaneously

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Construction of recombinant plasmids

[0101] 1. pDGI-7S6-P 43 -PhoD-MTSase-spyCatcher-6xHis plasmid construction

[0102] (1) Clone the promoter P 43 Gene fragment

[0103] Using the Bacillus subtilis genome as a template, design primers for PCR amplification of the promoter P 43 Gene fragment.

[0104] The promoter P 43 For PCR amplification of gene fragments, the nucleotide sequences of primers are as follows:

[0105] P 43 -1-F: aaaactggtctgatc ggatcc AGCTTCGTGCATGCAGGC SEQ ID NO. 1;

[0106] The underline is the BamHI restriction site;

[0107] P 43 - PhoD-2-R: GACTGTCGTATGCCATGTGTACATTCCTCTCTTA SEQ ID NO. 2;

[0108] The PCR reaction system is as follows:

[0109] 10 μmol / L upstream primer P 43 -1-F 2.5 μL, 10 μmol / L downstream primer P 43 -PhoD-2-R 2.5μL, gene template 2.5μL, 2×Phanta Max Master Mix 25μL, with ddH 2 O supplemented to 50 μL;

[0110] The above-mentioned PCR reaction is carried out according to the following procedures:

[0111] Pr...

Embodiment 2

[0220] Preparation of B. subtilis WB800n electroporation competent cells

[0221] Pick a single colony of B. subtilis WB800n on the surface of fresh LB solid medium and culture it for 12 hours in 5 mL LB liquid medium; take 1 mL of the 12-hour culture and insert it into 50 mL GM medium (GM medium: LB+0.5M sorbitol) Medium, cultured with shaking at 37°C to OD 600 is 1.0. Put the bacterial solution in an ice-water bath for 10 minutes, centrifuge at 5000 rpm at 4°C for 8 minutes, and collect the bacterial cells; resuspend the bacterial cells with 20 mL of pre-cooled ETM medium (ETM medium: 0.5M sorbitol+0.5M mannitol+10% glycerol), Centrifuge at 5000 rpm at 4°C for 8 min, remove the supernatant, and wash 3 times in this way; resuspend the washed bacteria in 500 μL of ETM medium, and distribute them in EP tubes, 60 μL per tube.

Embodiment 3

[0223] The recombinant plasmid prepared in embodiment 1 is transferred in the B.subtilis WB800n prepared in embodiment 2

[0224] 6 μL pDGI-7S6-P 43 -PhoD-MTSase-spyCatcher-6xHis plasmid was added to 60 μL of B.subtilis WB800n competent cells, incubated on ice for 5 minutes, added to a pre-cooled electroporation cup (2mm), and electroporated at 2500V and 5ms. After electroporation, Immediately add 1 mL of 37°C preheated RM medium (RM medium: LB+0.5M sorbitol+0.38M mannitol) to the electroporation cup, revive and culture at 37°C for 3 hours, and spread on the medium containing 100ug / mL spectinomycin On the LB plate, cultivate it upside down at 37°C, and screen the strains containing spectinomycin resistance as positive recombinant bacteria B.subtilis WB800n / P 43 -PhoD-MTSase-spyCatcher-6xHis. Transferring Spectinomycin Resistance Elimination Plasmid pTSC into Positive Recombinant B. subtilis WB800n / P 43 - In PhoD-MTSase-spyCatcher-6xHis, the transformant was spread on a 5ug / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to the construction and application of a recombinant Bacillus subtilis that secretes MTHase ​​and MTSase synchronously, by constructing the self-installation module plasmid pDGI‑7S6‑P 43 ‑PhoD‑MTSase‑spyCatcher‑6xHis and plasmid pAX01‑7S6‑P 43 ‑PhoD‑spyTag‑linker‑spyTag‑MTHase‑spyTag‑6xHis, transform the constructed self-assembly module plasmid into B. subtilis WB800n cells to obtain seamless integration of recombinant B. subtilis WB800n; the recombinant bacteria are secreted and expressed, and MTSase ‑In vitro assembly of MTHase ​​multi-enzyme complex, double-enzyme conversion to produce trehalose experiment, the conversion rate of trehalose was increased to 81.5%.

Description

technical field [0001] The invention relates to the construction and application of a recombinant Bacillus subtilis that secretes MTHase ​​and MTSase simultaneously, and belongs to the technical field of genetic engineering and fermentation engineering. Background technique [0002] Trehalose (Trehalose) is a non-reducing disaccharide composed of two molecules of glucopyranose linked by 1,1-glycosidic bonds. It widely exists in bacteria, yeast, fungi, plants, animals and other organisms. [0003] Trehalose widely exists in nature and has special properties such as moderate sweetness, stable properties, not easy to decompose, and no reduction, as well as biological macromolecular protective agents. In particular, it has a non-specific protective effect on biological macromolecules, so it has great application potential in medicine, agriculture, cosmetics, food and other industries. Since the 1980s, research on the physiology, biochemistry and molecular biology of trehalose h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/75C12N15/54C12N15/56C12N1/21C12P19/14C12P19/12C12R1/125
CPCC12N9/1051C12N9/2402C12N15/75C12P19/14C12P19/12C12Y204/01245C12Y302/01028
Inventor 王腾飞宋龙祥刘洪玲
Owner QILU UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap