Construction and application of a recombinant Bacillus subtilis that secretes mthase and mtsase simultaneously
A technique for secreting signal peptides from Bacillus subtilis, which is applied in the fields of genetic engineering and fermentation engineering to achieve the effect of improving cascaded catalytic efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0100] Construction of recombinant plasmids
[0101] 1. pDGI-7S6-P 43 -PhoD-MTSase-spyCatcher-6xHis plasmid construction
[0102] (1) Clone the promoter P 43 Gene fragment
[0103] Using the Bacillus subtilis genome as a template, design primers for PCR amplification of the promoter P 43 Gene fragment.
[0104] The promoter P 43 For PCR amplification of gene fragments, the nucleotide sequences of primers are as follows:
[0105] P 43 -1-F: aaaactggtctgatc ggatcc AGCTTCGTGCATGCAGGC SEQ ID NO. 1;
[0106] The underline is the BamHI restriction site;
[0107] P 43 - PhoD-2-R: GACTGTCGTATGCCATGTGTACATTCCTCTCTTA SEQ ID NO. 2;
[0108] The PCR reaction system is as follows:
[0109] 10 μmol / L upstream primer P 43 -1-F 2.5 μL, 10 μmol / L downstream primer P 43 -PhoD-2-R 2.5μL, gene template 2.5μL, 2×Phanta Max Master Mix 25μL, with ddH 2 O supplemented to 50 μL;
[0110] The above-mentioned PCR reaction is carried out according to the following procedures:
[0111] Pr...
Embodiment 2
[0220] Preparation of B. subtilis WB800n electroporation competent cells
[0221] Pick a single colony of B. subtilis WB800n on the surface of fresh LB solid medium and culture it for 12 hours in 5 mL LB liquid medium; take 1 mL of the 12-hour culture and insert it into 50 mL GM medium (GM medium: LB+0.5M sorbitol) Medium, cultured with shaking at 37°C to OD 600 is 1.0. Put the bacterial solution in an ice-water bath for 10 minutes, centrifuge at 5000 rpm at 4°C for 8 minutes, and collect the bacterial cells; resuspend the bacterial cells with 20 mL of pre-cooled ETM medium (ETM medium: 0.5M sorbitol+0.5M mannitol+10% glycerol), Centrifuge at 5000 rpm at 4°C for 8 min, remove the supernatant, and wash 3 times in this way; resuspend the washed bacteria in 500 μL of ETM medium, and distribute them in EP tubes, 60 μL per tube.
Embodiment 3
[0223] The recombinant plasmid prepared in embodiment 1 is transferred in the B.subtilis WB800n prepared in embodiment 2
[0224] 6 μL pDGI-7S6-P 43 -PhoD-MTSase-spyCatcher-6xHis plasmid was added to 60 μL of B.subtilis WB800n competent cells, incubated on ice for 5 minutes, added to a pre-cooled electroporation cup (2mm), and electroporated at 2500V and 5ms. After electroporation, Immediately add 1 mL of 37°C preheated RM medium (RM medium: LB+0.5M sorbitol+0.38M mannitol) to the electroporation cup, revive and culture at 37°C for 3 hours, and spread on the medium containing 100ug / mL spectinomycin On the LB plate, cultivate it upside down at 37°C, and screen the strains containing spectinomycin resistance as positive recombinant bacteria B.subtilis WB800n / P 43 -PhoD-MTSase-spyCatcher-6xHis. Transferring Spectinomycin Resistance Elimination Plasmid pTSC into Positive Recombinant B. subtilis WB800n / P 43 - In PhoD-MTSase-spyCatcher-6xHis, the transformant was spread on a 5ug / ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


