Gene editing system based on CRISPR-Cas9 technology and application of gene editing system

A gene editing and gene technology, applied in the field of gene editing system, can solve the problems of large base size of plasmid, off-target gene editing, difficult Pf multiple rounds of gene editing, etc., and achieve the effect of reducing use and base size

Pending Publication Date: 2020-07-21
BLUE ELEGANT BIOTECH CO LTD
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The disadvantages of these two systems are: 1. The worms after gene editing contain drug resistance selection markers and residues of Cas9 protein expression vectors
At present, the resistance screening markers available in Pf are very limited, only hdhfr, bsd (blasticidin Sdeaminase), neo (neomycin phosphotransferase), pac (puromycin-N-acetyltransferase), and ydhodh (yeast dihydroorotate dehydrogenase) are available for selection, and Drugs are expensive, and some of them have not been commercialized; if multiple genes of Plasmodium need to be edited, the above two gene editing systems may be difficult to achieve multiple rounds of gene editing for Pf due to insufficient drug screening markers; and the Cas9 protein Residues of the expression vector will cause potential off-target risk of gene editing; 2. The size of the plasmid carrying the homology arm for homology repair is relatively large, and it is difficult to load large fragments for knock-in operation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene editing system based on CRISPR-Cas9 technology and application of gene editing system
  • Gene editing system based on CRISPR-Cas9 technology and application of gene editing system
  • Gene editing system based on CRISPR-Cas9 technology and application of gene editing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Example 1 Design and Construction of Universal Cas9 / sgRNA Expression Vector pCBS-yfcu Plasmid

[0087] First, the Cas9 / sgRNA expression vector pCBS plasmid was improved, and the negative selection gene yfcu derived from Saccharomyces cerevisiae was introduced into the vector;

[0088] Since the size of the pCBS plasmid has exceeded 12kb, and a complete negative selection gene expression cassette is inserted, the size will be close to 15kb; in order to reduce the difficulty of vector construction, the yeast-derived negative selection gene yfcu and cas9 gene were incorporated into the same expression cassette, The two are connected by a 2A peptide sequence (SEQ ID NO.2: GGTTCGGGAGAGGGCAGAGGATCCCTGCTAACATGCGGTGATGTCGAGGAGAATC CTGGCCCAGAATCGCTCGAG), and the yfcu-2A fusion gene is directly inserted into the XhoI site before the ORF of the Cas9 gene. The specific construction process is as follows:

[0089] The first step: pCC4 plasmid (Maier, AG., et al. (2006). "Negative se...

Embodiment 2

[0117] Example 2 Design and Construction of Universal Rescue Vector pARM-BtgZI(GFP / RUC)BtgZI

[0118] The structure of the rescue vector is as figure 2 As shown, its main components are: a 5' end promoter (5'PfEf1α, elongation factor 1-alpha, Gene ID: PF3D7_1357000) of the translation elongation factor of P. falciparum and Plasmodium berghei bifunctional Reporter gene GFP and renilla luciferase expression cassette (GFP / RUC), with BtgZI restriction sites at both ends of the GFP and renilla luciferase coding sequences, the reporter gene GFP / RUC can be replaced with other genes by cutting with BtgZI. There are multiple enzyme cutting sites (MCs) upstream of 5'-PfEf1α and downstream of 3'-PbDT for inserting 5' and 3' homology arms; an ampicillin (Amp) expression cassette, Used to screen positive clones and maintain the stability of the plasmid in Escherichia coli (such as DH5α, XL-10, Stbl3 and NEB Stable and other plasmid DNA cloning strains); The plasmid DNA replication ori...

Embodiment 3

[0146] Example 3 Screening of Cas9 / sgRNA targets

[0147] Use sgRNAcas9 software (Java version) for target screening, import the target gene sequence and Pf genome sequence as required, and set parameters; the target sequence, that is, the sgRNA sequence should be 5'-N(19)GG, 5'-N( 20) GG or 5'-N(21)GG sequence, preferably 5'-N(20)GG sequence; since the present invention does not use in vitro transcription, but only constructs a common plasmid vector, the sgRNA sequence of the present invention refers to sgRNA Corresponding DNA sequence.

[0148] Select the Pf non-essential gene Pf47 as the target gene, enter the Pf47 gene sequence of Pf3D7 (GeneID: PF3D7_1346800) and the Pf3D7 genome sequence (downloaded from the PlasmoDB database) in the sgRNAcas9 software, and select the possibility of off-target in the genome according to the results given by the software The lowest target, its sequence is AACTACAGTTGGCTTAACATGG; in order to avoid the constructed vector being cut by Cas9,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene editing system based on a CRISPR-Cas9 technology and application of the gene editing system. Based on an endogenous U6 promoter dependent-form vector system, a negative selection marker is added into a Cas9 expression box of an expression vector, an anti-drug selection marker on a rescue vector containing a homologous arm is transferred onto the expression vector, thus the base size of the rescue vector is decreased, and the capacity of the rescue vector is increased; and an exogenous gene segment lengthening out to 6.3 kb can be input in human plasmodium in a mediated mode, obtained recombinant plasmodium does not contain the anti-drug selection marker and Cas9 protein expression plasmid residue, continuous gene editing can be conducted through the same drugselection marker, and the gene editing system is stable in performance, efficient, concise, and powerful in function, and has wide application prospects and huge market value.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a gene editing system and application based on CRISPR-Cas9 technology. Background technique [0002] Gene editing is a technology that uses artificial nucleases or "molecular scissors" to insert, delete or replace DNA, including the first-generation ZFN zinc finger nuclease technology, the second-generation TALEN technology and the third-generation CRISPR / Cas9 technology . CRISPR / Cas9 technology has the advantages of simple design, multiple sites, high efficiency, good specificity, and short time-consuming. It is currently the hottest gene editing technology. The main components of the CRISPR / Cas9 system are sgRNA (single guide RNA) targeting the target gene and Cas9 nuclease. The working principle of this system is that Cas9 nuclease, under the guidance of sgRNA, cuts at a specific site of the target gene to generate a gap. After the gap is generated, cells can repair it in a varie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/79C12N15/90C12N1/11C12R1/90
CPCC12N15/79C12N15/902C12N2810/10C12N15/90C12N5/16C12N15/85C12R2001/90C12N1/105Y02A50/30
Inventor童英卢俊南张明虹陈立志梁兴祥姚永超秦莉陈小平
OwnerBLUE ELEGANT BIOTECH CO LTD