Gene editing system based on CRISPR-Cas9 technology and application of gene editing system
A gene editing and gene technology, applied in the field of gene editing system, can solve the problems of large base size of plasmid, off-target gene editing, difficult Pf multiple rounds of gene editing, etc., and achieve the effect of reducing use and base size
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Example 1 Design and Construction of Universal Cas9 / sgRNA Expression Vector pCBS-yfcu Plasmid
[0087] First, the Cas9 / sgRNA expression vector pCBS plasmid was improved, and the negative selection gene yfcu derived from Saccharomyces cerevisiae was introduced into the vector;
[0088] Since the size of the pCBS plasmid has exceeded 12kb, and a complete negative selection gene expression cassette is inserted, the size will be close to 15kb; in order to reduce the difficulty of vector construction, the yeast-derived negative selection gene yfcu and cas9 gene were incorporated into the same expression cassette, The two are connected by a 2A peptide sequence (SEQ ID NO.2: GGTTCGGGAGAGGGCAGAGGATCCCTGCTAACATGCGGTGATGTCGAGGAGAATC CTGGCCCAGAATCGCTCGAG), and the yfcu-2A fusion gene is directly inserted into the XhoI site before the ORF of the Cas9 gene. The specific construction process is as follows:
[0089] The first step: pCC4 plasmid (Maier, AG., et al. (2006). "Negative se...
Embodiment 2
[0117] Example 2 Design and Construction of Universal Rescue Vector pARM-BtgZI(GFP / RUC)BtgZI
[0118] The structure of the rescue vector is as figure 2 As shown, its main components are: a 5' end promoter (5'PfEf1α, elongation factor 1-alpha, Gene ID: PF3D7_1357000) of the translation elongation factor of P. falciparum and Plasmodium berghei bifunctional Reporter gene GFP and renilla luciferase expression cassette (GFP / RUC), with BtgZI restriction sites at both ends of the GFP and renilla luciferase coding sequences, the reporter gene GFP / RUC can be replaced with other genes by cutting with BtgZI. There are multiple enzyme cutting sites (MCs) upstream of 5'-PfEf1α and downstream of 3'-PbDT for inserting 5' and 3' homology arms; an ampicillin (Amp) expression cassette, Used to screen positive clones and maintain the stability of the plasmid in Escherichia coli (such as DH5α, XL-10, Stbl3 and NEB Stable and other plasmid DNA cloning strains); The plasmid DNA replication ori...
Embodiment 3
[0146] Example 3 Screening of Cas9 / sgRNA targets
[0147] Use sgRNAcas9 software (Java version) for target screening, import the target gene sequence and Pf genome sequence as required, and set parameters; the target sequence, that is, the sgRNA sequence should be 5'-N(19)GG, 5'-N( 20) GG or 5'-N(21)GG sequence, preferably 5'-N(20)GG sequence; since the present invention does not use in vitro transcription, but only constructs a common plasmid vector, the sgRNA sequence of the present invention refers to sgRNA Corresponding DNA sequence.
[0148] Select the Pf non-essential gene Pf47 as the target gene, enter the Pf47 gene sequence of Pf3D7 (GeneID: PF3D7_1346800) and the Pf3D7 genome sequence (downloaded from the PlasmoDB database) in the sgRNAcas9 software, and select the possibility of off-target in the genome according to the results given by the software The lowest target, its sequence is AACTACAGTTGGCTTAACATGG; in order to avoid the constructed vector being cut by Cas9,...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com