Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Application of plant amino acid permease and coding genes thereof to regulation and control of high temperature resistance of plants

A plant amino acid and coding gene technology, which is applied to the application field of plant amino acid permease and its coding gene in regulating the high temperature resistance of plants, can solve the problems of investing a lot of manpower, material resources and time in heat-resistant varieties, and achieve improved breeding. Efficiency, increase vigor, shorten the effect of breeding cycle

Active Publication Date: 2020-07-24
CHINA AGRI UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] However, there are some problems in the above-mentioned methods: the selection and breeding of heat-resistant varieties needs to invest a lot of manpower, material resources and time, and a variety of identification methods are used to select and breed heat-resistant varieties from many varieties, and finally the heat-resistant varieties are selected for promotion and planting.
The method of enhancing plant tolerance through reasonable management in the field requires the implementer to have mature field management experience, and can only resist high temperature to a small extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of plant amino acid permease and coding genes thereof to regulation and control of high temperature resistance of plants
  • Application of plant amino acid permease and coding genes thereof to regulation and control of high temperature resistance of plants
  • Application of plant amino acid permease and coding genes thereof to regulation and control of high temperature resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Construction of CRISPR / Cas9 Knockout Vector pBUE-ZmAAPa

[0063] In order to realize the knockout of the amino acid permease ZmAAPa gene (the amino acid sequence of the encoded protein is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2) in maize, the present embodiment constructs using CRISPR / Cas9 The knockout vector pBUE-ZmAAPa (construction strategy such as figure 1 shown).

[0064] First, use the CRISPR-PLANT (http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html) website to screen out the sequence with the NGG target site in the ZmAAPa gene, and then use the Cas-OFFinder (http: / / www. .rgenome.net / cas-offinder / ) website to assess off-target situations. Finally, the two targets located in the coding region with the fewest off-target sites were screened. The target sequences of the ZmAAPa gene are respectively TGGACGTTGGTAGCGCGGAGG (SEQ ID NO.3) at 692bp of the coding region sequence and CCTGGGCTACTCGGCGTTCGG (SEQ ID NO.4) at 890...

Embodiment 2

[0071] The genetic transformation of the immature embryo of embodiment 2 maize

[0072] The pBUE-ZmAAPa vector constructed in Example 1 was used to transform immature maize embryos by Agrobacterium infection, and the maize inbred line 178 was used as the transformation recipient, and the immature embryos of the 178 inbred line were stripped 12 days after pollination. Select the immature embryos with a diameter of 1.5-2.0mm, light yellow color and good condition, and use Agrobacterium bacterium liquid (OD 600 0.80) for 30 minutes, and the immature embryos after infection were grown on the co-cultivation medium at 28°C in the dark for 3 days, then transferred to the recovery medium and cultured for 7 days, and then transferred to the selection medium containing Basta. There were three rounds of screening, each round was two weeks, the concentration of Basta in the first round was 3 mg / L, the second round was 5 mg / L, and the third round was 8 mg / L. Transfer the screened callus t...

Embodiment 3

[0076] Example 3 Detection of ZmAAPa Knockout Corn Materials

[0077]Detection of marker gene expression: Bar test strips (purchased from EnviroLogix, USA) were used to detect the expression of glufosinate resistance gene protein level. Take a few leaves of transgenic plants and freeze them with liquid nitrogen, grind them into powder, add a little buffer solution (purchased from EnviroLogix, USA) and put them into test strips, and the results will be displayed in 1-2 minutes. If one band is displayed, it is a negative result, and if two bands are displayed, it indicates that the Bar protein is successfully expressed ( figure 2 ).

[0078] Two sgRNA target site cleavage analysis of ZmAAPa: design primers KN-ZmAAPa-F:5′-CACCCAGAACACGGGCTCCTAC-3′ and KN-ZmAAPa-R:5′-CGAAGTCCACCAGCCAGTAGGG-3′, extract maize positive for Bar test strips Genomic DNA of the plant, a sequence including two sgRNA target sites on the target gene ZmAAPa was amplified by PCR, and the target band size w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant biotechnology and genetic breeding technology, in particular to an application of plant amino acid permease and coding genes thereof to regulation and control of high temperature resistance of plants. The invention discloses participation of a ZmAAPa gene of corn amino acid permease in regulation and control of the tolerance of corn pollen to high temperature stress. The knockout of the ZmAAPa gene can significantly improve the tolerance of the corn pollen to the high temperature stress. A corn material with the ZmAAPa gene knocked out is obtained through a CRISPR / Cas9 technology and corn genetic transformation, the germination rate of the corn pollen under the high temperature stress condition is remarkably increased through knockout of the ZmAAPa gene, and normal development of pollen and anther is not affected.

Description

technical field [0001] The invention relates to the technical fields of plant biotechnology and genetic breeding, in particular to the application of plant amino acid permease and its coding gene in regulating the high temperature resistance performance of plants. Background technique [0002] The impact of global warming on the ecological environment is becoming more and more serious. The research report of the Intergovernmental Panel on Climate Change (IPCC) of the United Nations pointed out that compared with the end of the 20th century, the current global temperature has increased by about 4°C, and the temperature Elevation will seriously affect crop growth and threaten food security (Lobell et al., 2011). [0003] Studies have found that plants are more sensitive to high temperature during the reproductive growth stage, and pollen, as the male gametophyte of plants, is more susceptible to high temperature than the female gametophyte (Lizaso et al., 2018), usually in an ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/82A01H5/02A01H6/46
CPCC12N9/00C12N15/8251C12N15/827C12N15/8271
Inventor 赵倩袁晓红于静娟朱登云樊柳
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com