Application of plant amino acid permease and coding genes thereof to regulation and control of high temperature resistance of plants
A plant amino acid and coding gene technology, which is applied to the application field of plant amino acid permease and its coding gene in regulating the high temperature resistance of plants, can solve the problems of investing a lot of manpower, material resources and time in heat-resistant varieties, and achieve improved breeding. Efficiency, increase vigor, shorten the effect of breeding cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Example 1 Construction of CRISPR / Cas9 Knockout Vector pBUE-ZmAAPa
[0063] In order to realize the knockout of the amino acid permease ZmAAPa gene (the amino acid sequence of the encoded protein is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2) in maize, the present embodiment constructs using CRISPR / Cas9 The knockout vector pBUE-ZmAAPa (construction strategy such as figure 1 shown).
[0064] First, use the CRISPR-PLANT (http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html) website to screen out the sequence with the NGG target site in the ZmAAPa gene, and then use the Cas-OFFinder (http: / / www. .rgenome.net / cas-offinder / ) website to assess off-target situations. Finally, the two targets located in the coding region with the fewest off-target sites were screened. The target sequences of the ZmAAPa gene are respectively TGGACGTTGGTAGCGCGGAGG (SEQ ID NO.3) at 692bp of the coding region sequence and CCTGGGCTACTCGGCGTTCGG (SEQ ID NO.4) at 890...
Embodiment 2
[0071] The genetic transformation of the immature embryo of embodiment 2 maize
[0072] The pBUE-ZmAAPa vector constructed in Example 1 was used to transform immature maize embryos by Agrobacterium infection, and the maize inbred line 178 was used as the transformation recipient, and the immature embryos of the 178 inbred line were stripped 12 days after pollination. Select the immature embryos with a diameter of 1.5-2.0mm, light yellow color and good condition, and use Agrobacterium bacterium liquid (OD 600 0.80) for 30 minutes, and the immature embryos after infection were grown on the co-cultivation medium at 28°C in the dark for 3 days, then transferred to the recovery medium and cultured for 7 days, and then transferred to the selection medium containing Basta. There were three rounds of screening, each round was two weeks, the concentration of Basta in the first round was 3 mg / L, the second round was 5 mg / L, and the third round was 8 mg / L. Transfer the screened callus t...
Embodiment 3
[0076] Example 3 Detection of ZmAAPa Knockout Corn Materials
[0077]Detection of marker gene expression: Bar test strips (purchased from EnviroLogix, USA) were used to detect the expression of glufosinate resistance gene protein level. Take a few leaves of transgenic plants and freeze them with liquid nitrogen, grind them into powder, add a little buffer solution (purchased from EnviroLogix, USA) and put them into test strips, and the results will be displayed in 1-2 minutes. If one band is displayed, it is a negative result, and if two bands are displayed, it indicates that the Bar protein is successfully expressed ( figure 2 ).
[0078] Two sgRNA target site cleavage analysis of ZmAAPa: design primers KN-ZmAAPa-F:5′-CACCCAGAACACGGGCTCCTAC-3′ and KN-ZmAAPa-R:5′-CGAAGTCCACCAGCCAGTAGGG-3′, extract maize positive for Bar test strips Genomic DNA of the plant, a sequence including two sgRNA target sites on the target gene ZmAAPa was amplified by PCR, and the target band size w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


