Unlock instant, AI-driven research and patent intelligence for your innovation.

Establishment method of maize male sterile line

A technique for establishing a male sterile line and method, applied in the directions of botanical equipment and methods, biochemical equipment and methods, angiosperms/flowering plants, etc., can solve the problem of reducing seed production income, limited male sterile lines, and increasing breeding costs. and other problems, to achieve the effect of broad application prospects

Active Publication Date: 2020-08-11
SHENYANG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the corn hybrids used in production are obtained by artificial detasseling of the female parent and crossing with the male parent, but manual detasseling consumes a lot of manpower, material and financial resources, increases the cost of breeding, and reduces the income of seed production
Maize hybrid seed production needs to be hybridized with specific parents to obtain high-yield maize hybrid varieties, but the male sterile lines used in production are relatively limited, which often cannot meet the needs of seed production. Interfering with the expression of essential genes for pollen development under the drive of progeny can artificially create maize male sterile lines of different parents, which has important application value in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Establishment method of maize male sterile line
  • Establishment method of maize male sterile line
  • Establishment method of maize male sterile line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1. Cloning of maize pollen-specific promoter sequence pPSP1

[0055] After sterilizing the surface of the seeds of the corn cultivar McC, place them in a petri dish covered with wet filter paper, and cultivate them at 24-28°C for 3-5 days to make them grow young leaves, collect 2g of fresh and tender seedlings, and extract the total DNA, take 2-3μL DNA sample, and use agarose gel electrophoresis to detect the purity and concentration.

[0056] Design cloning primers, F: AGTAGGCCAAAATTTCCAAACA; R: CAGCTCCTGCTCCAAGATTGACG, use the above primers for PCR reaction, the reaction components are as follows: LA taq polymerase 0.2μL, GC buffer 5μL, dNTP 1.5μL, F primer 0.2μL, R primer 0.2μL, Template DNA 2μL , ddH 2 O 1.9 μL.

[0057] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 2 min, 35 cycles of amplification, extension at 72°C for 5 min, and storage at ...

Embodiment 2

[0058] Example 2. Construction of plant expression vector pCambia1301-pPSP1-GUS

[0059] Build process such as figure 2 As shown, the pMD19T-pPSP1-HN plasmid (constructed in Example 1) was extracted by alkali cleavage method, and after HindIII and NcoI double digestion, the pPSP1 promoter fragment with HindIII and NcoI restriction sites was obtained, which was similarly digested with The large fragment of the plant expression vector pCambia1301 was ligated, and then the ligated product was transformed into 2 In E. coli DH5α competent cells treated by the method, cultivate overnight on LB solid medium containing kanamycin (final concentration 100 μg / ml); pick the white colony grown on the plate, insert into containing kanamycin ( The LB liquid medium with a final concentration of 100 μg / ml) was cultured overnight, and the bacterial cells were collected by centrifugation to extract the plasmid by alkaline lysis, which was identified by restriction endonuclease HindIII and NcoI...

Embodiment 3

[0060] Example 3. pCambia1301-pPSP-GUS expression vector transformation of maize germinated embryos

[0061] The recombinant plant expression vector pCambia1301-pPSP1-GUS constructed in Example 2 was transformed into Agrobacterium tumefaciens EHA105 by freezing and thawing, and the transformation method was referred to [Hofen R, Willmitzer L, (1988) Storage ofcompetent cells for Agrobacterium transformation. Acids Research, 16, 9877].

[0062] Utilize the method for exogenous gene transformation of maize germination embryo, operate according to the test procedure of people such as Wang (2007), as follows:

[0063] (1) Agrobacterium liquid preparation: pick and identify positive Agrobacterium colonies (pCambia1301-pPSP1-GUS), inoculate them into 50mL YEB liquid medium containing Kanamycin and Rifampicin antibiotics, keep the temperature at 28°C, shake at 200rpm for 8-12hr , measure OD 600 A value of 0.8 is used directly for infection;

[0064] (2) Preparation of corn recepto...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an establishment method of a maize male sterile line. The method comprises steps as follows: plant expression vectors of antisense fragments of EN1 and EN2 genes which containa maize pollen specific promoter pPSP1 and are in operatable connection with the promoter are used for transforming the maize, and the maize male sterile line realizing specific silencing expression of the EN1 and EN2 genes in pollen is obtained, wherein the maize pollen specific promoter pPSP1 has the sequence represented in SEQ ID NO.1 or the DNA sequence which is capable of hybridizing with thesequence represented in SEQ ID NO.1 under the strict condition and has activity of the promoter. According to the establishment method of the maize male sterile line, the maize pollen specific promoter pPSP1 is connected with antisense genes of genes essential for pollen development, the genes essential for pollen development can be expressed silently when the vectors are transformed into plant,a pollen abortion plant is produced, besides, adverse effects caused by continuous expression of target genes in other parts are avoided, and the establishment method has broad application prospects in the aspects of genetic improvement of the plants and research of plant bioreactors.

Description

technical field [0001] The invention relates to a method for establishing a maize male sterile line. The invention belongs to the technical field of agricultural production. Background technique [0002] Male sterility is a common phenomenon in the plant world, which means that the stamens cannot grow normally and produce effective pollen during sexual reproduction, while the pistils can develop and fertilize normally. In hybrid breeding, high-yield hybrid varieties can be obtained by using male sterile lines as materials to control pollination. So far, breeders have found male sterility in 617 plant varieties or interspecific hybrids of 43 families, 162 genera, and 320 species, including corn, sorghum, rice, rape, rye, wheat, and pearl millet. In this way, cross-breeding work is carried out. In wheat, 42 varieties were bred using the male sterile RMs2 hybrid line, with a cultivated area of ​​12.3 million hectares 2 , Increased wheat production by 5.6 million tons. In r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/113C12N15/66A01H5/00A01H6/46
CPCC12N15/113C12N15/66C12N15/8218C12N15/8231C12N15/8289C12N2310/11
Inventor 刘琛林凤张春宇范眀霞孙权李楠
Owner SHENYANG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com