Application of genetic modification stem cell exosome to preparation of medicines or beautifying and whitening cosmetics
An exosome and epidermal stem cell technology, applied in cosmetics, cosmetic preparations, animal cells, etc., can solve the problem of insufficient research on melanocyte inhibition, achieve good medicinal and cosmetic application prospects, inhibit proliferation and migration, and inhibit tumors. effect of growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Preparation of exosomes from human epidermal stem cells
[0029] 1. Preparation of miR
[0030] miR-27b-3p: 5'-uucacaguggcuaaguucugc-3', miR-27b-3p inhibitor: 5'-gcagaacuuagccacugugaa-3', the nucleic acid was synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.
[0031] 2. Cell culture:
[0032] Human epidermal stem cells (purchased from Beina Bio, No. BNCC340781), cultured in 10% FBS+90% high glucose DMEM medium, 37°C, 5% CO 2 to cultivate. Epidermal stem cells in good growth state were collected, counted by centrifugation, and counted at 5×10 3 Spread each well in a 96-well plate at 37°C, 5% CO 2 Cultivate for 24h.
[0033] 3. Transfection:
[0034] 1) One day before transfection, inoculate cultured cells in a 96-well plate with an appropriate amount of medium without antibiotics, so that the confluence of cells reaches 50% during transfection;
[0035] 2) Transfection samples Prepare the oligomer-Lipofecta mineTM2000 complex as follows: ...
Embodiment 2
[0041] Example 2 Identification of Transgenic Epidermal Stem Cells
[0042] The expression of miR-27b-3p in transgenic epidermal stem cells was detected by RT-qPCR. When the growth state of the cells prepared in Example 1 is good and the number reaches 80%, add 1mL TRIzol and 200μL chloroform to lyse, then shake the sample for 30s, 4°C, centrifuge at 14000×g for 15min to collect the precipitate, then add 60 μL DEPC water to dissolve The precipitate was extracted by adding an equal volume of phenol, chloroform and isopropanol, 1 μL RNA was diluted 50 times, and the absorbance (OD) value was measured on a microplate reader. miR-27b-3p forward primer: ctcaactggtgtcgtggagt, reverse primer: acactccagctggguucaca, internal reference U6 forward primer: ctcgcttcggcagcaca, reverse primer: aacgcttcacgaatttgcgt, using 2 -ΔΔCT The method was used to analyze the experimental data, detect the expression of miR-27b-3p, and select two positive transgenic cells and control cells for detection, t...
Embodiment 3
[0044] Example 3 Preparation of exosomes from transgenic stem cells
[0045] Collection of exosomes: Take the 3rd generation cells, when the cells grow to 80-90% confluent, change the serum-free medium and culture for 48 hours, and collect the cell supernatant. The collected cell supernatant was centrifuged at 300×g for 10 min to remove dead cells and large cell debris, centrifuged at 2000×g for 10 min to remove dead cells and cell debris, and centrifuged at 10000×g / min for 30 min to remove larger capsules of cell debris Bubbles were filtered through a 0.22 μm syringe filter to remove microbubbles and possible apoptotic bodies. Use a 20mL empty needle to transfer the supernatant to an ultracentrifuge tube, 10 6 Centrifuge at × g for 60 min, remove the supernatant, collect the precipitate, and obtain crude exosomes, centrifuge at 106 × g for 60 min, remove the supernatant, dissolve the precipitate with 100 μL PBS, and obtain relatively pure exosomes. All the above operations ...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap