Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of genetic modification stem cell exosome to preparation of medicines or beautifying and whitening cosmetics

An exosome and epidermal stem cell technology, applied in cosmetics, cosmetic preparations, animal cells, etc., can solve the problem of insufficient research on melanocyte inhibition, achieve good medicinal and cosmetic application prospects, inhibit proliferation and migration, and inhibit tumors. effect of growth

Active Publication Date: 2020-09-11
GUANGDONG CELL BIOTECHNOLOGY CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Although there have been researches on the inhibition of melanocytes by exosomes from other cells, the research on the inhibition of melanocytes by exosomes from epidermal stem cells is not enough, because the epidermal stem cells of the skin have a relatively active cell morphology, and their Exosomes have a good effect on the repair and help of the skin in theory. Therefore, choosing epidermal stem cells as the research object requires vigorous development.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of genetic modification stem cell exosome to preparation of medicines or beautifying and whitening cosmetics
  • Application of genetic modification stem cell exosome to preparation of medicines or beautifying and whitening cosmetics
  • Application of genetic modification stem cell exosome to preparation of medicines or beautifying and whitening cosmetics

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Preparation of exosomes from human epidermal stem cells

[0029] 1. Preparation of miR

[0030] miR-27b-3p: 5'-uucacaguggcuaaguucugc-3', miR-27b-3p inhibitor: 5'-gcagaacuuagccacugugaa-3', the nucleic acid was synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.

[0031] 2. Cell culture:

[0032] Human epidermal stem cells (purchased from Beina Bio, No. BNCC340781), cultured in 10% FBS+90% high glucose DMEM medium, 37°C, 5% CO 2 to cultivate. Epidermal stem cells in good growth state were collected, counted by centrifugation, and counted at 5×10 3 Spread each well in a 96-well plate at 37°C, 5% CO 2 Cultivate for 24h.

[0033] 3. Transfection:

[0034] 1) One day before transfection, inoculate cultured cells in a 96-well plate with an appropriate amount of medium without antibiotics, so that the confluence of cells reaches 50% during transfection;

[0035] 2) Transfection samples Prepare the oligomer-Lipofecta mineTM2000 complex as follows: ...

Embodiment 2

[0041] Example 2 Identification of Transgenic Epidermal Stem Cells

[0042] The expression of miR-27b-3p in transgenic epidermal stem cells was detected by RT-qPCR. When the growth state of the cells prepared in Example 1 is good and the number reaches 80%, add 1mL TRIzol and 200μL chloroform to lyse, then shake the sample for 30s, 4°C, centrifuge at 14000×g for 15min to collect the precipitate, then add 60 μL DEPC water to dissolve The precipitate was extracted by adding an equal volume of phenol, chloroform and isopropanol, 1 μL RNA was diluted 50 times, and the absorbance (OD) value was measured on a microplate reader. miR-27b-3p forward primer: ctcaactggtgtcgtggagt, reverse primer: acactccagctggguucaca, internal reference U6 forward primer: ctcgcttcggcagcaca, reverse primer: aacgcttcacgaatttgcgt, using 2 -ΔΔCT The method was used to analyze the experimental data, detect the expression of miR-27b-3p, and select two positive transgenic cells and control cells for detection, t...

Embodiment 3

[0044] Example 3 Preparation of exosomes from transgenic stem cells

[0045] Collection of exosomes: Take the 3rd generation cells, when the cells grow to 80-90% confluent, change the serum-free medium and culture for 48 hours, and collect the cell supernatant. The collected cell supernatant was centrifuged at 300×g for 10 min to remove dead cells and large cell debris, centrifuged at 2000×g for 10 min to remove dead cells and cell debris, and centrifuged at 10000×g / min for 30 min to remove larger capsules of cell debris Bubbles were filtered through a 0.22 μm syringe filter to remove microbubbles and possible apoptotic bodies. Use a 20mL empty needle to transfer the supernatant to an ultracentrifuge tube, 10 6 Centrifuge at × g for 60 min, remove the supernatant, collect the precipitate, and obtain crude exosomes, centrifuge at 106 × g for 60 min, remove the supernatant, dissolve the precipitate with 100 μL PBS, and obtain relatively pure exosomes. All the above operations ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of a genetic modification stem cell exosome to preparation of medicines or beautifying and whitening cosmetics. miR-27b-3p is used for transfection of epidermalstem cells and an exosome from genetic modification stem cells is obtained. Experiments prove that the exosome can restrain expression of PIK3R3 proteins in melanocyte, can also restrain proliferation and migration of the melanocyte. Safety experiments also prove the safety of the exosome. Therefore, the exosome has good medical and cosmetic application prospects when being made into corresponding medicines or cosmetics.

Description

technical field [0001] The present invention relates to the biological field, in particular to the use of transgenic stem cell exosomes in the preparation of medicines or whitening cosmetics. Background technique [0002] Exosome secretion is a pervasive cellular function. Exosomes have been proven to be composed of unique lipids and proteins, which can deliver various bioactive molecules, such as proteins, membrane receptors, mRNA and microRNA, etc., and participate in intercellular communication, regulation of the immune system and the transfer of genetic material. [0003] In recent years, researchers have linked exosomes to skin diseases and found that exosomes not only participate in skin physiological and pathological processes, such as regulating the secretion of pro-inflammatory cytokines in the skin microenvironment, promoting angiogenesis and collagen deposition in skin defects, and Regulate the proliferation and differentiation of skin fibroblasts, and at the sam...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K35/28A61K8/99A61P35/00A61Q19/02C12N15/87C12N5/10
CPCA61K35/28A61K8/99A61Q19/02A61P35/00C12N15/87C12N5/0625C12N2510/00C12N2509/00A61K35/36A61P17/00C12N5/0626C12N2502/09C12N2500/34C12N2533/90C12N15/88C12N2310/141A61K8/985A61K8/14A61K8/606A61K9/127A61K2800/86C12N5/063C12N15/113
Inventor 彭菲李静
Owner GUANGDONG CELL BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com