Unlock instant, AI-driven research and patent intelligence for your innovation.

Schizochytrium sp. genetic engineering strain overexpressing squalene synthetase gene, as well as construction method and application of schizochytrium sp. genetic engineering strain

A technique of squalene synthase and genetically engineered strains, applied in the field of genetic engineering, to achieve the effects of weakening lipid metabolism pathways, increasing accumulation, and enhancing metabolism

Inactive Publication Date: 2020-11-06
XIAMEN UNIV
View PDF8 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far there is no method of genetically engineering Schizochytrium to produce squalene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Schizochytrium sp. genetic engineering strain overexpressing squalene synthetase gene, as well as construction method and application of schizochytrium sp. genetic engineering strain
  • Schizochytrium sp. genetic engineering strain overexpressing squalene synthetase gene, as well as construction method and application of schizochytrium sp. genetic engineering strain
  • Schizochytrium sp. genetic engineering strain overexpressing squalene synthetase gene, as well as construction method and application of schizochytrium sp. genetic engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1. Cloning of Schizochytrium squalene synthase gene (SQS)

[0053] According to the sequence information of the Schizochytrium squalene synthase gene (SQS), design primers P1 and P2 as shown in SEQ ID No.1 and SEQ ID No.2 respectively, and the underlined parts are restriction enzyme cutting sites NheI and XbaI uses the Schizochytrium sp.ATCC1381 genome as a template, and uses primers P1 / P2 and PrimerStar high-fidelity polymerase to amplify squalene synthase by PCR to obtain a squalene synthase gene (SQS) fragment. The PCR program was: 94°C for 30s, 60°C for 30s, 72°C for 1.5min, 34 cycles, and the PCR product was purified, and the purified product was verified by 1% agarose gel electrophoresis.

[0054] SEQ ID No.1 P1 (sense): GCG TCTAGA ATGTTCTCCATGCTCACATT

[0055] SEQ ID No.2 P2 (antisense): GCG GCTAGC TTAGTCAGAGTGGGTTTGGCC

Embodiment 2

[0056] Example 2. Construction of overexpression vector pBluzeo-SQS-18S

[0057] 1. Enzyme digestion reaction

[0058] The overexpression vector plasmid pBluzeo-18S (plasmid source: purchased from Shanghai Sangon Bioengineering (Shanghai) Co., Ltd.) and the PCR purified product squalene synthase gene (SQS ) fragments, gel recovery. Digestion system (50 μL): 2 μL NheI, 2 μL XbaI, 5 μL Loading Buffer, 20 μL plasmid or PCR purified product, 21 μL ddH 2 O, 37 ° C water bath enzyme digestion 2h. The digested product was recovered by 1% agarose gel electrophoresis.

[0059] 2. Connection reaction

[0060] The digested squalene synthase gene (SQS) fragment and the vector pBluzeo-18S fragment were ligated with T4 ligase, and ligated at 16°C for 12 hours to obtain the recombinant overexpression vector pBluzeo-SQS-18S. Ligation system (25 μL): 2 μL target gene fragment, 1 μL vector digested fragment, 2.5 μL ligase buffer, 19.5 μL ddH 2 O, 16°C connection for 12h.

[0061] 3. Tran...

Embodiment 3

[0067] Embodiment 3. Construction of the Schizochytrium genetic engineering strain of overexpressing squalene synthase gene (SQS)

[0068] 1. Preparation of Schizochytrium Competent Cells

[0069] (1) Pick a single colony of the activated Schizochytrium sp.ATCC1381 Schizochytrium sp.ATCC1381 on the plate to 50mL seed medium, and culture it on a shaker at 28°C and 200r / min for 24h.

[0070] (2) Transfer to 50mL seed culture medium according to 4% inoculum size, and culture on a shaker at 200r / min at 28°C for 24h.

[0071] (3) Take 20 mL of bacterial liquid, centrifuge at 4000 rpm for 2 min at room temperature, and discard the supernatant.

[0072] (4) Resuspend the bacteria with 25 mL of pretreatment agent (20 mM pH 6.5 phosphate buffer containing 25 mL of DTT), shake at 150 rpm for 30 min to loosen the cell wall.

[0073] (5) The cells were washed twice with 20 mL of pre-cooled sterile water, and the centrifugation conditions were: 4000 rpm, 4° C. for 2 min.

[0074] (6) Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a schizochytrium sp. genetic engineering strain overexpressing a squalene synthetase gene, as well as a construction method and application of the schizochytrium sp. genetic engineering strain. Schizochytrium sp. ATCC1381 is adopted as an original strain, an overexpression vector is constructed in escherichia coli through the means of genetic engineering, bleomycin is selected as a screening resistance gene, the highly conserved sequence 18S rRNA of eucaryon is used as a homologous arm, a linear overexpressed fragment is electro-transformed into the schizochytrium sp toobtain a genetic engineering strain with high yield of squalene, and a theoretical basis is laid for microbial produced squalene and product industrialization.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a Schizochytrium genetically engineered bacterial strain and a construction method and application thereof. Background technique [0002] Squalene is a lipid unsaponifiable substance composed of 6 isoprene units. It is widely used in food, medical treatment, beauty and other fields because of its various functions such as defense against viruses, anti-aging, and anti-tumor. The main source of squalene in the current market is shark liver oil, which is also abundant in vegetable oil. As the market demand for squalene is increasing day by day, the limitation of natural resources and the complex reactions and extremely low yields of chemical synthesis methods make squalene unable to meet the demand, so the way of using microbial resources to produce squalene has become the future development trend. This method has attracted great attention due to the advantages of sh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/80C12P5/02C12R1/645
CPCC12N9/1085C12N15/80C12P5/026C12Y205/01021
Inventor 凌雪萍杨庆华张学良周豪卢英华陈翠雪
Owner XIAMEN UNIV