Schizochytrium sp. genetic engineering strain overexpressing squalene synthetase gene, as well as construction method and application of schizochytrium sp. genetic engineering strain
A technique of squalene synthase and genetically engineered strains, applied in the field of genetic engineering, to achieve the effects of weakening lipid metabolism pathways, increasing accumulation, and enhancing metabolism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Embodiment 1. Cloning of Schizochytrium squalene synthase gene (SQS)
[0053] According to the sequence information of the Schizochytrium squalene synthase gene (SQS), design primers P1 and P2 as shown in SEQ ID No.1 and SEQ ID No.2 respectively, and the underlined parts are restriction enzyme cutting sites NheI and XbaI uses the Schizochytrium sp.ATCC1381 genome as a template, and uses primers P1 / P2 and PrimerStar high-fidelity polymerase to amplify squalene synthase by PCR to obtain a squalene synthase gene (SQS) fragment. The PCR program was: 94°C for 30s, 60°C for 30s, 72°C for 1.5min, 34 cycles, and the PCR product was purified, and the purified product was verified by 1% agarose gel electrophoresis.
[0054] SEQ ID No.1 P1 (sense): GCG TCTAGA ATGTTCTCCATGCTCACATT
[0055] SEQ ID No.2 P2 (antisense): GCG GCTAGC TTAGTCAGAGTGGGTTTGGCC
Embodiment 2
[0056] Example 2. Construction of overexpression vector pBluzeo-SQS-18S
[0057] 1. Enzyme digestion reaction
[0058] The overexpression vector plasmid pBluzeo-18S (plasmid source: purchased from Shanghai Sangon Bioengineering (Shanghai) Co., Ltd.) and the PCR purified product squalene synthase gene (SQS ) fragments, gel recovery. Digestion system (50 μL): 2 μL NheI, 2 μL XbaI, 5 μL Loading Buffer, 20 μL plasmid or PCR purified product, 21 μL ddH 2 O, 37 ° C water bath enzyme digestion 2h. The digested product was recovered by 1% agarose gel electrophoresis.
[0059] 2. Connection reaction
[0060] The digested squalene synthase gene (SQS) fragment and the vector pBluzeo-18S fragment were ligated with T4 ligase, and ligated at 16°C for 12 hours to obtain the recombinant overexpression vector pBluzeo-SQS-18S. Ligation system (25 μL): 2 μL target gene fragment, 1 μL vector digested fragment, 2.5 μL ligase buffer, 19.5 μL ddH 2 O, 16°C connection for 12h.
[0061] 3. Tran...
Embodiment 3
[0067] Embodiment 3. Construction of the Schizochytrium genetic engineering strain of overexpressing squalene synthase gene (SQS)
[0068] 1. Preparation of Schizochytrium Competent Cells
[0069] (1) Pick a single colony of the activated Schizochytrium sp.ATCC1381 Schizochytrium sp.ATCC1381 on the plate to 50mL seed medium, and culture it on a shaker at 28°C and 200r / min for 24h.
[0070] (2) Transfer to 50mL seed culture medium according to 4% inoculum size, and culture on a shaker at 200r / min at 28°C for 24h.
[0071] (3) Take 20 mL of bacterial liquid, centrifuge at 4000 rpm for 2 min at room temperature, and discard the supernatant.
[0072] (4) Resuspend the bacteria with 25 mL of pretreatment agent (20 mM pH 6.5 phosphate buffer containing 25 mL of DTT), shake at 150 rpm for 30 min to loosen the cell wall.
[0073] (5) The cells were washed twice with 20 mL of pre-cooled sterile water, and the centrifugation conditions were: 4000 rpm, 4° C. for 2 min.
[0074] (6) Th...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com