Aspergillus nidulans chitin deacetylase mutant
A technology of deacetylase and chitin, which is applied in the field of bioengineering, can solve the problem of difficult screening of chitin deacetylase strains and achieve the effect of improving catalytic efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0049] Implementation example 1: Construction of mutant expression plasmid and acquisition of recombinant Pichia pastoris
[0050] According to the AnCDA gene sequence XM_677557.1 in GenBank, the yeast expression codon was optimized, and the optimized enzyme gene was synthesized by GenScript Bioengineering Co., Ltd. Add an EcoRI restriction site at the 5' end of the target gene, add a histidine tag and a NotI restriction site at the 3' end, and use Primer Premier 5.0 to design primers:
[0051] AnCDA-EcoRI-F:
[0052] GGAATTCATGTTCGCAACCCTGGCCCTGGTGT
[0053] AnCDA-NotI-R: ATAAGAATGCGGCCGCTTAATGATGGTGATGATGATGATGATACCAGGCAATTT
[0054] The synthetic AnCDA gene was used as a template and the above primers were used for PCR amplification. The PCR amplification conditions were: 94°C for 5 min, 32 cycles (94°C for 30 s, 55°C for 30 s, 68°C for 30 s) and 4°C for termination.
[0055] The PCR product was recovered by gel to obtain a band of about 700 bp. The purified DNA and the...
Embodiment 2
[0074] Implementation Example 2: Induced Expression of Recombinant Bacteria
[0075] (1) BMGY liquid medium: Yeast extract 10 g / L, peptone 20 g / L, glycerol 10 ml / L, 0.1 mol / L potassium phosphate buffer at pH 7.0, sterilized at 121 °C for 20 min, and left to cool , add 100 mL of 10×YNB solution, 2 mL of 500× biotin solution, and store at 4°C for later use.
[0076] (2) BMMY liquid medium: Yeast extract 10 g / L, peptone 20 g / L, 0.1 mol / L, pH 7.0 potassium phosphate buffer, sterilized at 121 ℃ for 20 min, after cooling, add 10× YNB solution 100 mL, 500×biotin solution 2 mL, filter-sterilized methanol 1 mL, store at 4 ℃ for later use.
[0077](3) Induced expression of recombinant bacteria: Pick the recombinant bacteria and inoculate them in 20 mL of BMGY liquid medium, and culture them to OD at 28°C and 200 r / min 600 After reaching 2.0-6.0, collect the bacteria by centrifugation at 3000r / min for 1min, discard the supernatant, add 50 mL of BMMY liquid medium to resuspend, culture ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More