Unlock instant, AI-driven research and patent intelligence for your innovation.

Aspergillus nidulans chitin deacetylase mutant

A technology of deacetylase and chitin, which is applied in the field of bioengineering, can solve the problem of difficult screening of chitin deacetylase strains and achieve the effect of improving catalytic efficiency

Pending Publication Date: 2020-11-17
JIANGSU OCEAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing studies on chitin deacetylase are mostly carried out from the aspects of strain selection, enzyme purification, expression, enzymatic properties, and improvement of fermentation process. The above methods can obtain strains with high enzyme activity in a short period of time. However, limited by the enzyme production level of wild bacteria, it is difficult to screen and obtain novel chitin deacetylase strains with high catalytic efficiency. With the rapid development of enzyme engineering, especially directed evolution technology, in order to improve the catalytic efficiency of enzymes, this Invention discloses a marine bacterium Aspergillus nidulans ( A. nidulans ) Chitin deacetylase mutants, aiming to improve the catalytic properties of the enzyme by using techniques such as site-directed mutation, site-directed saturation mutation, and DNA-shuffling, to change the optimal catalytic temperature and optimal catalytic pH of the enzyme, and to improve Enzyme Catalytic Efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Implementation example 1: Construction of mutant expression plasmid and acquisition of recombinant Pichia pastoris

[0050] According to the AnCDA gene sequence XM_677557.1 in GenBank, the yeast expression codon was optimized, and the optimized enzyme gene was synthesized by GenScript Bioengineering Co., Ltd. Add an EcoRI restriction site at the 5' end of the target gene, add a histidine tag and a NotI restriction site at the 3' end, and use Primer Premier 5.0 to design primers:

[0051] AnCDA-EcoRI-F:

[0052] GGAATTCATGTTCGCAACCCTGGCCCTGGTGT

[0053] AnCDA-NotI-R: ATAAGAATGCGGCCGCTTAATGATGGTGATGATGATGATGATACCAGGCAATTT

[0054] The synthetic AnCDA gene was used as a template and the above primers were used for PCR amplification. The PCR amplification conditions were: 94°C for 5 min, 32 cycles (94°C for 30 s, 55°C for 30 s, 68°C for 30 s) and 4°C for termination.

[0055] The PCR product was recovered by gel to obtain a band of about 700 bp. The purified DNA and the...

Embodiment 2

[0074] Implementation Example 2: Induced Expression of Recombinant Bacteria

[0075] (1) BMGY liquid medium: Yeast extract 10 g / L, peptone 20 g / L, glycerol 10 ml / L, 0.1 mol / L potassium phosphate buffer at pH 7.0, sterilized at 121 °C for 20 min, and left to cool , add 100 mL of 10×YNB solution, 2 mL of 500× biotin solution, and store at 4°C for later use.

[0076] (2) BMMY liquid medium: Yeast extract 10 g / L, peptone 20 g / L, 0.1 mol / L, pH 7.0 potassium phosphate buffer, sterilized at 121 ℃ for 20 min, after cooling, add 10× YNB solution 100 mL, 500×biotin solution 2 mL, filter-sterilized methanol 1 mL, store at 4 ℃ for later use.

[0077](3) Induced expression of recombinant bacteria: Pick the recombinant bacteria and inoculate them in 20 mL of BMGY liquid medium, and culture them to OD at 28°C and 200 r / min 600 After reaching 2.0-6.0, collect the bacteria by centrifugation at 3000r / min for 1min, discard the supernatant, add 50 mL of BMMY liquid medium to resuspend, culture ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Aspergillus nidulans chitin deacetylase mutant. The Aspergillus nidulans chitin deacetylase mutant is characterized in that an amino acid sequence of Aspergillus nidulans chitin deacetylase is mutated as follows: leucine (L) at the site 139 is mutated into glycine (G), lysine (K) at the site 164 is mutated into glutamate (E), tyrosine (Y) at the site 166 is mutated intotryptophan (W), alanine (A) at the site 171 is mutated into tryptophan (W), alanine (A) at the site 195 is mutated into glutamate (E), and histidine (H) at the site 199 is mutated into asparagine (D);and a collection number of the amino acid sequence GenBank of the Aspergillus nidulans chitin deacetylase is XM_677557.1. A chitin deacetylase gene is modified through site-specific mutagenesis, so that the catalytic activity of the encoded chitin deacetylase is increased and is 2.95 times of that of a wild type enzyme, and the catalytic efficiency of the chitin deacetylase is greatly improved; and meanwhile, the Aspergillus nidulans chitin deacetylase mutant is suitable for meeting industrial production requirements and worthy of popularization.

Description

technical field [0001] The invention relates to the technical field of bioengineering and discloses marine bacteria A. nidulans Mutants of chitin deacetylases, in particular related to a Aspergillus nidulans Chitin deacetylase mutants. Background technique [0002] Chitin, also known as chitin or chitin, is widely found in the exoskeleton of crustaceans such as shrimps and crabs and the cell walls of algae and fungi. It is a common natural organic compound composed of N-acetyl-D-glucosamine through β- 1, 4 glycosidic bonds connected, insoluble in water and organic solvents, its development and application are limited, but the product obtained by removing more than 55% of the acetyl group from chitin is chitosan (Chitosan), also known as chitosan It is deacetylated chitin, chitosan or soluble chitin, which is a derivative produced by a certain degree of deacetylation of chitin. It is easily soluble in water and can be modified chemically. It is widely used in medical treat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/80C12N15/81C12N1/19C12R1/84
CPCC12N9/80C12N15/815C12Y305/01041C12N2800/22
Inventor 刘姝张春光杭加豪房耀维卢静杨杰侯晓月陈佳雨张弘彧
Owner JIANGSU OCEAN UNIV