Application of osbhlh6 in Improving Crop Phosphorus Uptake Capacity and Breeding of Crop Tolerance to Low Phosphorus
A technology that is resistant to low phosphorus and phosphorus absorption, applied in the field of plant genetic engineering, can solve problems such as accelerated soil degradation, low phosphorus fertilizer use efficiency, and water eutrophication
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Example 1. Construction of bHLH6 promoter fusion GUS reporter vector
[0081] To study the expression pattern of the bHLH6 gene (OsbHLH6) in different organs, the bHLH6 promoter sequence (3089 bp first of the genomic ATG) was cloned by PCR. The sequences of the used promoter PCR primers are as follows, the ends of the upstream and downstream primers are respectively added with Sal I and Kpn I recognition sites (underlined), and the size of the target promoter fragment is 3089 bp.
[0082] Upstream primer: 5'ACGC GTCGAC GAAATGCGTGCTAGCGATTGGCCGT 3’
[0083] Downstream primer: 5'CGG GGTACC GGCGCTTGCTCTGCTTCGCGTTTGC 3’
[0084] Using the genomic DNA of wild-type rice NIP as a template, the bHLH6 promoter was amplified with the above primers.
[0085] The promotor obtained by amplification is digested with Sal I / Kpn I double enzyme, and the obtained promotor fragment (SEQ ID NO:3) is connected into the carrier pBI101.3-GUS plus ( Image 6 b) Obtaining the bHLH6Pro::G...
Embodiment 2
[0098] Example 2. bHLH6 is a phosphorus starvation response gene
[0099] To clarify that bHLH6 is a phosphorus starvation-responsive gene, expression analysis under different culture conditions was performed. Seedlings grown for 7 days under normal phosphorus concentration (200 μm phosphorus concentration) were transferred to phosphorus starvation (-P, no Pi) at the indicated times (i.e., days 1, 3, 5 and 7 after 7 days of normal phosphorus growth). ) conditions (-P 1d-P 7d), or transferred to phosphorus-sufficient (phosphorus concentration of 200 μm) conditions for 1 d (after normal concentration growth for 7 days, phosphorus starvation for 7 days and phosphorus supply for 1 day) ( figure 2 a and 2b); wild-type seedlings grown at normal phosphorus concentration (200 μM) for 7 days were treated with high phosphorus (HP, 200 μM) or low phosphorus (LP, 10 μM) for 14 days ( figure 2 c).
[0100] The treated seedlings were sampled by real-time fluorescence quantitative PCR to...
Embodiment 3
[0107] Example 3. bHLH6 functions as a transcriptional activator
[0108] The subcellular localization of bHLH6 was studied by transient expression in protoplasts prepared from rice suspension cells, and the results showed that the bHLH6-GFP signal was mainly localized in the nucleus (for the vector, see Image 6 c, Lv et al., Plant Cell. 2014.26(4):1586-1597). In order to confirm that bHLH6 has transcriptional activation activity, the present invention carried out yeast activation activity analysis.
[0109] Ligation of various truncated and full-length bHLH6 into the pGBKT7 vector containing the GAL4 binding domain ( Image 6 a), construct a GAL4-BD fusion expression strain. AH109 yeast competent cells were transformed, and then transferred to tryptophan-deficient medium (SD / -Trp medium), and then transferred to histidine-deficient medium (SD / -His medium) for culture observation after normal growth.
[0110] Different truncated bHLH6s are specifically: 1-95aa, 96-144aa, 1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More