Human non-small cell lung cancer nucleic acid aptamer truncation body and application thereof

A non-small cell lung cancer, nucleic acid aptamer technology, applied in the field of biomedicine, can solve the problems of long length, small molecular weight, unsuitable for large-scale in vitro synthesis and modification, etc. The effect of easy large-scale chemical synthesis

Active Publication Date: 2021-03-26
BIOPHARMAGEN CORP FANGZHOU SUZHOU
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004]However, the length of aptamers obtained by traditional in vitro and in vivo screening is relatively long, which is not suitable for large-scale in vitro synthesis and modification. Therefore, further optimization of nucleic acid aptamer sequences Length, to obtain nucleic acid aptamer truncations with small molecular weight, easy synthesis and modification, and excellent specificity, affinity and physiological functions, which is more conducive to promoting the entry of nucleic acid aptamer drugs into the clinic

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human non-small cell lung cancer nucleic acid aptamer truncation body and application thereof
  • Human non-small cell lung cancer nucleic acid aptamer truncation body and application thereof
  • Human non-small cell lung cancer nucleic acid aptamer truncation body and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Amplification of nucleic acid aptamer truncations in human non-small cell lung cancer.

[0024] SEQ NO.1 sequence:

[0025] GGGAGAGAACAAUGACCUGCGGUGCCAAGCCGUCGGGUUAUGUUGAUCUCCUCAAGGACGAGUGCAUUG

[0026] The sequence can be obtained by in vitro synthesis or in vitro transcription, wherein the steps of in vitro transcription are as follows:

[0027] DNA template:

[0028] CACTAATACGACTCACTATAGGGAGAGAACAATGACCTGCGGTGCCAAGCCGTCGGGTTATGTTGATCTCCACAAGGACGAGTGCATTG.

[0029] Using the above DNA as a template and 2'F-dCTP, 2'F-dUTP, CTP, ATP, amino-GMP as substrates, the in vitro transcription reaction was carried out. The reaction conditions are: 37°C, 8h. After the reaction was completed, the DNA template was removed with DNase I, and the purified RNA aptamer truncated body was obtained by phenol / chloroform extraction and ethanol precipitation, which was named truncated body S3.

[0030] 5' PEG and NH on truncation S3 2 Modification:

[0031] 5' PEG modificat...

Embodiment 2

[0034] Example 2 The binding effect of the nucleic acid aptamer truncation in human non-small cell lung cancer.

[0035] Fluorescently label the truncated body S3 of the nucleic acid aptamer: aminally-dUTP is incorporated during transcription, the molar ratio of aminally-dUTP to 2'F-dUTP is 1:5, and NHS-labeled fluorescent dye (material Alexa Fluor 488) in 0.1M NaHCO 3 React in the buffer solution for 2 hours at room temperature, and remove unreacted fluorescent dye by ultrafiltration through a YM-10 column.

[0036] The binding effect of the nucleic acid aptamer of the present invention to human non-small cell lung cancer NCI-H460 cells (purchased from ATCC) was detected by fluorescence microscopy. Human non-small cell lung cancer NCI-H460 cells were cultured in a 24-well plate, the medium was poured out, and the H460 cells were washed three times with PBS, and then mixed with 200 nM RA16 and the nucleic acid aptamer truncation S3 bindingbuffer (0.2mM Tris(pH7.5), 0.5M NaCl...

Embodiment 3

[0037] Example 3 Binding specificity of nucleic acid aptamer truncations for human non-small cell lung cancer.

[0038] The specificity of the nucleic acid aptamer truncation of the present invention binding to human non-small cell lung cancer NCI-H460 cells was detected by flow cytometry. Experiments have proved that the truncated form S3 of RA16 can also specifically recognize and inhibit human non-small cell lung cancer cell lines, such as image 3 As shown, the truncated form S3 of RA16 still has specific binding ability to human non-small cell lung cancer H460 cell line. At the same time, we calculated by flow cytometry that the Kd value of truncated body S3 for human non-small cell lung cancer H460 is about 63.20±0.91nM.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human non-small cell lung cancer nucleic acid aptamer truncation body. The truncation body is characterized in that on the basis of a human non-small cell lung cancer targeting and tumor inhibition bispecific nucleic acid aptamer obtained by early-stage living body screening, the sequence of the nucleic acid aptamer is simplified, an original sequence containing 83 nucleotides is shortened to a sequence containing 69 nucleotides, and extremely high specificity and affinity to human non-small cell lung cancer and an inhibition effect on tumor cell proliferation are still kept. The obtained human non-small cell lung cancer aptamer truncation body is shorter in length and smaller in molecular weight; fragments of the truncation body are subjected to 5' end PEG and NH2 modification; compared with a long-chain RNA aptamer, the truncation body can be subjected to large-scale chemical synthesis more easily and is low in cost; and meanwhile, the truncation body has the advantages of being good in stability, easy to store and modify and the like.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to the sequence of a human non-small cell lung cancer nucleic acid aptamer truncated body. Background technique [0002] Cancer has become one of the leading causes of death in the world population. According to statistics, 7 people die of cancer every minute in the whole country. Among them, lung cancer is the malignant disease with the highest morbidity and mortality rate in the world and in the whole country. At present, surgical resection and traditional chemotherapy are commonly used clinical treatments, but the high recurrence rate and side effects of surgery and chemotherapy have always been clinical problems that need to be solved urgently. There is an urgent need to adopt new methods and means to treat lung cancer patients and improve the quality of patients. The development of targeted diagnostic or therapeutic drugs that can specifically recognize tumor tissue rath...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/115G01N33/574G01N33/533A61K31/7088A61P35/00
CPCC12N15/115G01N33/57423G01N33/533A61K31/7088A61P35/00C12N2310/16C12N2320/30
Inventor王含璐蒋永平
OwnerBIOPHARMAGEN CORP FANGZHOU SUZHOU