Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

1048 results about "Pulmonary Cancers" patented technology

Small-cell carcinoma (also known as "small-cell lung cancer", or "oat-cell carcinoma") is a type of highly malignant cancer that most commonly arises within the lung, although it can occasionally arise in other body sites, such as the cervix, prostate, and gastrointestinal tract.

Method for diagnosing non-small cell lung cancers

Disclosed are methods for detecting, diagnosing, treating and preventing non-small cell lung cancer using differentially expressed genes. Furthermore, novel human genes, whose expression is elevated in non-small cell lung cancer compared to non-cancerous tissues, are provided. Also disclosed are agents for treating and preventing non-small cell lung cancer as well as methods for identifying further compounds for treating and preventing non-small cell lung cancer.
Owner:ONCOTHERAPY SCI INC

Novel peptides and combination of peptides for use in immunotherapy against small cell lung cancer and other cancers

The present invention relates to peptides, proteins, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated T-cell peptide epitopes, alone or in combination with other tumor-associated peptides that can for example serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses, or to stimulate T cells ex vivo and transfer into patients. Peptides bound to molecules of the major histocompatibility complex (MHC), or peptides as such, can also be targets of antibodies, soluble T-cell receptors, and other binding molecules.
Owner:IMMATICS BIOTECHNOLOGIES GMBH

Composition and vaccine for treating lung cancer

InactiveUS20160168227A1High in proteinEffectively stimulating the (adaptive) immune systemOrganic active ingredientsTumor rejection antigen precursorsAntigenDisease
The present invention relates to a composition comprising at least one mRNA encoding a combination of antigens capable of eliciting an (adaptive) immune response in a mammal, wherein the antigens are selected from the group consisting of 5T4 (Trophoblast glycoprotein, TPBG), Survivin (Baculoviral TAP repeat-containing protein 5; BIRC5), NY-ESO-1 (New York esophageal squamous cell carcinoma 1, CTAG1B), MAGE-C1 (Melanoma antigen family C1), MAGE-C2 (Melanoma antigen family C2), and MUC1 (Mucin 1). The invention furthermore relates to a vaccine comprising at least one mRNA encoding such a combination of antigens, and to the use of said composition (for the preparation of a vaccine) and / or of the vaccine for eliciting an (adaptive) immune response for the treatment of lung cancer, preferably of non-small cell lung cancer (NSCLC), and diseases or disorders related thereto. Finally, the invention relates to kits, particularly to kits of parts, containing the composition and / or the vaccine.
Owner:CUREVAC AG

Diamino heterocyclic carboxamide compound

Provided is a compound useful as an inhibitor against the kinase activity of EML4-ALK fusion protein.As a result of intensive and extensive studies on compounds having inhibitory activity against the kinase activity of EML4-ALK fusion protein, the present inventors found that the diamino heterocyclic carboxamide compounds of the present invention had inhibitory activity against the kinase activity of EML4-ALK fusion protein. By this finding, the present invention was completed. The compounds of the present invention can be used as a pharmaceutical composition for preventing and / or treating cancer, such as lung cancer, non-small cell lung cancer, and small cell lung cancer.
Owner:ASTELLAS PHARMA INC +1

Methods of treating cancer

The present invention provides methods and compositions for treating non-small-cell lung cancer (NSCLC) by administering a) a composition comprising nanoparticles that comprise paclitaxel and an albumin and b) a platinum-based agent (e.g., carboplatin). The present application also provides methods of treating prostate cancer by administering to the individual a) an effective amount of a composition comprising nanoparticles comprising docetaxel and an albumin; and b) an effective amount of a steroid.
Owner:ABRAXIS BIOSCI LLC

Methods of treating cancer

The present invention provides methods and compositions for treating non-small-cell lung cancer (NSCLC) by administering a) a composition comprising nanoparticles that comprise paclitaxel and an albumin and b) a platinum-based agent (e.g., carboplatin). The present application also provides methods of treating prostate cancer by administering to the individual a) an effective amount of a composition comprising nanoparticles comprising docetaxel and an albumin; and b) an effective amount of a steroid.
Owner:ABRAXIS BIOSCI LLC

Methods for the detection and treatment of cancer

Methods are provided for the detection of and determining prognosis of metastatic breast, lung, prostate, and / or pancreatic cancer using various genetic markers, including markers for gene clusters linked by Esx. In one method, breast cancer micrometastases and non-small cell lung cancer metastases or micrometastases are detected in a patient by determining whether the AGR2 or TFF1 genes are overexpressed in a cell sample compared to control lymph node tissue cells. In a further method, the likelihood that a patient diagnosed with breast cancer will respond to hormonal therapy is predicted by determining a higher expression level of the AGR2 gene compared to a control gene. In a further method, a decreased probability of survival for a patient diagnosed with early stage non-small cell lung cancer is predicted by determining a higher expression level of the AGR2 gene compared to a control gene. Kits for practicing the methods of the invention are further provided. Methods are also provided for the identification of markers for which overexpression is indicative of the presence of micrometastatic disease.
Owner:MUSC FOUND FOR RES DEV

Apoptosis inducing adamantyl derivatives and their usage as anti-cancer agents

InactiveUS6127415APreventing and controlling photoinducedPreventing and controlling and chronologic agingBiocideCosmetic preparationsDiseaseAnticarcinogen
PCT No. PCT / US97 / 11564 Sec. 371 Date Apr. 14, 1999 Sec. 102(e) Date Apr. 14, 1999 PCT Filed Jul. 8, 1997 PCT Pub. No. WO98 / 01132 PCT Pub. Date Jan. 15, 1998The present invention relates to specific adamantyl or adamantyl group derivative containing retinoid compounds induce apoptosis of cancer cells. These adamantyl retinoid derivatives are useful for the treatment of many cancers and solid tumors, especially androgen-independent prostate cancer, skin cancer, pancreatic carcinomas, colon cancer, melanoma, ovarian cancer, liver cancer, small cell lung carcinoma, non-small cell lung carcinoma, cervical carcinoma, brain cancer, bladder cancer, breast cancer, neuroblastoma / glioblastoma, and leukemia. Also, the invention relates to novel adamantyl or adamantyl group derivative compounds which are useful as active agents for the treatment or prevention of keratinization disorders and other dermatological conditions, and other diseases.
Owner:GALDERMA RES & DEV SNC

Therapeutic morpholino-substituted compounds

Morpholino-substituted pyridopyrimidine, quinolone, and benzopyranone derivatives inhibit phosphoinositide (PI) 3-kinase, an enzyme that regulates platelet-adhesion processes. As a consequence, the compounds in question have anti-thrombotic activity, as well as other pharmaceutical properties. The compounds claimed are represented by formula (I), (II) and (III). PI 3-kinase generates 3-phosphorylated PI second messengers which stimulate platelet adhesion under blood-flow conditions. Because platelet adhesion is a necessary step in the formation of a thrombus, inhibition by these compounds of PI 3-kinase under such conditions inhibits or prevents thrombus formation. The compounds are useful in treating PI 3-kinase-dependent conditions including cardiovascular diseases such as coronary artery occlusion, stroke, acute coronary syndrome, acute myocardial infarction, vascular restenosis, atherosclerosis, and unstable angina; respiratory diseases such as asthma, chronic obstructive pulmonary diseases (COPD), and bronchitis; inflammatory disorders; neoplasms including cancers such as glioma, prostate cancer, small cell lung cancer, and breast cancer, and diseases linked to disordered white blood cell function, such as autoimmune and inflammatory diseases.
Owner:ASTRAZENECA AB

Dipeptide boric acid composed of carboxylic acid and alpha-amino acid as well as ester compound thereof, and preparation method and application of dipeptide boric acid and ester compound thereof

The invention belongs to the field of drug synthesis and in particular relates to a series of novel peptide boric acids as well as an ester compound or pharmaceutical salt thereof, and a preparation method and application of the peptide boric acids as well as the ester compound or pharmaceutical salt thereof in pharmacodynamics. A structure of the peptide boric acid and the ester compound or pharmaceutical salt thereof is shown in a formula I (described in the specification). The compound provided by the invention can be used for preparing a proteasome inhibitor and can further be used for treating solid tumours and blood tumours, wherein the solid tumours are selected from non-small cell lung cancer, small cell lung cancer, lung adenocarcinoma, lung squamous carcinoma, pancreatic cancer, breast cancer, prostate cancer, liver cancer, skin cancer, epithelial cell cancer, gastrointestinal stromal tumor, nasopharynx cancer and leukemia; and the blood tumours are selected from multiple myeloma, mantle cell lymphoma and histiocytic lymphoma.
Owner:JIANGSU CHIA TAI FENGHAI PHARMA

N-acyl ureas exhibiting anti-cancer and anti-proliferative activities

Compounds of the present invention find utility in the treatment of mammalian cancers and especially human cancers including, but not limited to, malignant melanomas, solid tumors, glioblastomas, ovarian cancer, pancreatic cancer, prostate cancer, lung cancers, breast cancers, kidney cancers, hepatic cancers, cervical carcinomas, metastasis of primary tumor sites, myeloproliferative diseases, chronic myelogenous leukemia, leukemias, papillary thyroid carcinoma, non-small cell lung cancer, mesothelioma, hypereosinophilic syndrome, gastrointestinal stromal tumors, colonic cancers, ocular diseases characterized by hyperproliferation leading to blindness including various retinopathies, diabetic retinopathy, rheumatoid arthritis, asthma, chronic obstructive pulmonary disease, mastocytosis, mast cell leukemia, and diseases caused by PDGFR-α kinase, PDGFR-β kinase, c-KIT kinase, cFMS kinase, c-MET kinase, and oncogenic forms, aberrant fusion proteins and polymorphs of any of the foregoing kinases.
Owner:DECIPHERA PHARMA LLC

Genetic Alterations Useful For The Response Prediction of Malignant Neoplasia to Taxane-Based Medical Treatments

The invention provides novel compositions, methods and uses, for the diagnosis, prognosis, prediction, prevention and aid in treatment of malignant neoplasia such as breast cancer, ovarian cancer, gastric cancer, colon cancer, esophageal cancer, mesenchymal cancer, bladder cancer or non-small cell lung cancer. Genes that are chromosomally amplified in breast tissue of breast cancer patients are disclosed. Further disclosed are chromosomally amplified genes and non-amplified genes that correlate to Taxane resistance, Taxane benefit or adverse Taxane reaction, which can be used as an aid to make therapy dicisions.
Owner:SIEMENS HEALTHCARE DIAGNOSTICS GMBH

Gemcitabine hydrochloride lyophilized powder injection

The invention relates to a gemcitabine hydrochloride lyophilized powder injection and a preparation method thereof. The gemcitabine hydrochloride lyophilized powder injection prepared by the method can be used as a therapeutic medicament for treating middle and late non-small cell lung cancer, pancreatic cancer and the like. The gemcitabine hydrochloride lyophilized powder injection is characterized by consisting of gemcitabine hydrochloride, mannitol and sodium acetate, wherein the weight ratio of the gemcitabine hydrochloride to the mannitol is 1:0.5-5, and the weight ratio of the gemcitabine hydrochloride to the sodium acetate is 1:0.01-0.1. The preparation method comprises the following steps: taking the mannitol and the sodium acetate; dissolving the mannitol and the sodium acetate by adding injection water; adding the gemcitabine hydrochloride to the mixture, stirring and dissolving the mixture, and adjusting the pH to between 2.7 and 3.3; fixing the volume; filtering the product by a 0.22 mu m microporous membrane; filling, dishing up, lyophilizing, and compressing; taking the product out of a box, and tying the product with an aluminum-plastic composite cover; and inspecting the quality, and packaging the product after passing the quality inspection to obtain the gemcitabine hydrochloride lyophilized powder injection.
Owner:JIANGSU AOSAIKANG PHARMA CO LTD

Gene defects and mutant ALK kinase in human solid tumors

In accordance with the invention, novel gene deletions and translocations involving chromosome 2 resulting in fusion proteins combining part of Anaplastic Lymphoma Kinase (ALK) kinase with part of a secondary protein have now been identified in human solid tumors, e.g. non-small cell lung carcinoma (NSCLC). Secondary proteins include Echinoderm Microtubule-Associated Protein-Like 4 (EML-4) and TRK-Fusion Gene (TFG). The EML4-ALK fusion protein, which retains ALK tyrosine kinase activity, was confirmed to drive the proliferation and survival of NSCLC characterized by this mutation. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ALK kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of this new fusion protein enables new methods for determining the presence of these mutant ALK kinase polypeptides in a biological sample, methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides, which are also provided by the invention.
Owner:CELL SIGNALING TECHNOLOGY

Kinase inhibitors useful for the treatment of proliferative diseases

The present invention relates to novel kinase inhibitors and modulator compounds useful for the treatment of various diseases. More particularly, the invention is concerned with such compounds, kinase / compound adducts, methods of treating diseases, and methods of synthesis of the compounds. Preferrably, the compounds are useful for the modulation of kinase activity of Raf kinases and disease polymorphs thereof. Compounds of the present invention find utility in the treatment of mammalian cancers and especially human cancers including but not limited to malignant melanoma, colorectal cancer, ovarian cancer, papillary thyroid carcinoma, non small cell lung cancer, and mesothelioma. Compounds of the present invention also find utility in the treatment of rheumatoid arthritis and retinopathies including diabetic retinal neuropathy and macular degeneration.
Owner:DECIPHERA PHARMA LLC

Method for treating non-small cell lung cancer

InactiveUS20130310440A1Organic active ingredientsRespiratory disorder5-MethylcytosineBorderline resectable
The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.
Owner:TEVA PHARMA IND LTD

Non-small cell lung cancer (NSCLC) marker and its application

Belonging to the field of biotechnology, the invention discloses a non-small cell lung cancer (NSCLC) marker, which is STAT3, and also can include CEA, CA125 and CYFRA21-1. The invention confirms the high expression of STAT3 in peripheral blood and serum, and discloses application of STAT3 in preparation of NSCLC diagnostic reagents by the inventor. Specifically, by making use of a genetic recombination technology and targeting at the gene coding region of STAT3, an eukaryotic expression vector PSUPER-STAT3 able to transcribe in vivo and generate small interference RNA (siRNA) is constructed successfully, and is transfected into an eukaryotic cell, thus laying a foundation for a further experimental study on lung cancer RNAi (RNA interference) and antitumor gene therapy. Utilization of the RNAi technology can effectively inhibit the gene expression of STAT3, induce cell apoptosis, and establish the base for molecular mechanism research and gene therapy of lung cancer, thus providing application of the marker provided in the invention in preparing related targeted medicines.
Owner:THE AFFILIATED HOSPITAL OF SOUTHWEST MEDICAL UNIV

Protein tyrosine kinase modulators and methods of use

Heterocyclic pyrimidine compounds that modulate mutant-selective epidermal growth factor receptor (EGFR) and ALK kinase activity are disclosed. More specifically, the invention provides pyrimidines which inhibit, regulate and / or modulate kinase receptor, particularly in selectively modulation of various EGFR mutant activity and ALK kinase activity have been disclosed. Pharmaceutical compositions comprising the pyrimidine derivative,and methods of treatment for diseases associated with protein kinase enzymatic activity, particularly EGFR or ALK kinase activity including non-small cell lung cancer comprising administration of the pyrimidine derivative are disclosed.
Owner:BETTA PHARM CO LTD

Portable device for pulmonary cancer diagnosis

The invention provides a portable device for diagnosis of lung cancer, which comprises a balloon, a gas pump, a buffer gas chamber, a reaction gas chamber, an image collection and processing system and a control system; the balloon collects exhaled gas of a patient with suspected lung cancer to carry out the reaction with a pre-designed porphyrin sensor array (the sensor array for detecting lung cancer markers, if the lung cancer markers exist, the color of the sensor array is changed before and after the reaction) in the reaction gas chamber, the collection of images before and after the reaction is realized by controlling the image collection and processing system through the control system, the images are compared, the collected images are carried out with the pretreatment to obtain the differential images before and after the reaction, the differential images are further compared with data in an expert lesion database to obtain the detection result, and the detection result is finally displayed through a liquid crystal screen or a micro-printer, thereby judging whether the patient suffers from the lung cancer or not.
Owner:CHONGQING UNIV

Di(arylamino)aryl compound

The present invention provides a compound which is useful as an inhibitor against the kinase activity of EML4-ALK fusion proteins and mutant EGFR proteins.As a result of extensive and intensive studies on compounds having an inhibitory effect against the kinase activity of EML4-ALK fusion proteins and mutant EGFR proteins, the inventors of the present invention have found that the di(arylamino)aryl compound of the present invention has inhibitory activity against the kinase activity of EML4-ALK fusion proteins and mutant EGFR proteins. This finding led to the completion of the present invention. The compound of the present invention can be used as a pharmaceutical composition for preventing and / or treating cancer, lung cancer, non-small cell lung cancer, small cell lung cancer, EML4-ALK fusion polynucleotide-positive and / or mutant EGFR polynucleotide-positive cancer, EML4-ALK fusion polynucleotide-positive and / or mutant EGFR polynucleotide-positive lung cancer, or EML4-ALK fusion polynucleotide-positive and / or mutant EGFR polynucleotide-positive non-small cell lung cancer, etc.
Owner:ASTELLAS PHARMA INC

Veratramine degradation product veratrum fluorene aldehyde and the derivatives thereof, as well as the preparation and application thereof

The invention provides a veratramine degradation product veratrum fluorene aldehyde 1 and derivatives thereof. The invention uses steroidal alkaloid veratramine (A) as raw material and prepares veratrum fluorene aldehyde by oxidative degradation of m-chloroperoxybenzoic acid to obtain 20 derivative compounds of the veratrum fluorene aldehyde 1 after further oxidation, reduction and condensation reaction. The 20 compounds of the invention have good inhibitory activity on cancer cells, wherein the compounds 1, 2, 5, 8, 13 and 17 have good inhibitory activity on cells of human pancreatic cancer cells BxPC-3 and SW1990, small-cell lung cancer cells NCI-H446, human colorectal cancer LOVO and the like, and the inhibitory activity of the compound veratrum fluorene aldehyde 1 is the most significant.
Owner:SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY

Method for diagnosing lung cancers using gene expression profiles in peripheral blood mononuclear cells

Methods and compositions are provided for diagnosing lung cancer in a mammalian subject by use of three or more selected genes, e.g., a gene expression profile, from the peripheral blood mononuclear cells (PBMC) of the subject which is characteristic of disease, a stage of the disease, or enables prognosis of recurrence of disease. The gene expression profile includes three or more genes of Table I, Table II, Table III, Table IV, Table V, Table VI or Table VII herein. Detection of changes in expression in the selected genes forming the gene expression profile from that of a reference gene expression profile are correlated with non-small cell lung cancer (NSCLC). One composition for use in such diagnosis includes three or more PCR primer-probe sets, wherein each primer-probe set amplifies a different polynucleotide sequence from the gene expression profile. Another composition for similar use contains a plurality of polynucleotides immobilized on a substrate, which probes hybridize to three or more gene expression products from genes in the gene expression profile. Still another composition involves detection of the protein expression products of genes from the gene expression profile.
Owner:THE WISTAR INST OF ANATOMY & BIOLOGY

Use of dianhydrogalactitol and analogs or derivatives thereof in combination with platinum-containing antineoplastic agents to treat non-small-cell carcinoma of the lung and brain metastases

The use of dianhydrogalactitol provides a novel therapeutic modality for the treatment of non-small-cell lung carcinoma (NSCLC) and ovarian cancer, as well as other types of malignancy, including brain metastases of NSCLC. Dianhydrogalactitol acts as an alkylating agent on DNA that creates N7 methylation. Dianhydrogalactitol is effective in suppressing the growth of cancer stem cells and is active against tumors that are refractory to temozolomide, cisplatin, and tyrosine kinase inhibitors; the drug acts independently of the MGMT repair mechanism. Dianhydrogalactitol can be used together with other anti-neoplastic agents and can possess additive or super-additive effects.
Owner:DEL MAR PHARMA

EGFR inhibitor, preparation method and use thereof

Epidermal growth factor receptor (EGFR) inhibitors are provided. In particular, 4-substituted-2-(N-(5-substituted allyl amide)phenyl)amino)pyrimidine derivatives of formula (I), a preparation method and use thereof as an EGFR inhibitor are provided. The 4-substituted-2-(N-(5-substituted allyl amide)phenyl)amino)pyrimidine derivatives of formula (I) have inhibitory activity against the L858R EGFR mutant, the T790M EGFR mutant and the exon 19 deletion activating mutant, and can be used to treat diseases mediated alone or in part by EGFR mutant activity. The derivatives of formula (I) can be used to treat and / or prevent cancers, particularly non-small cell lung cancer.
Owner:SHANGHAI HANSOH BIOMEDICAL +1

Aptamer for typing different subtypes of non-small cell lung cancer and method for screening the same

The invention discloses aptamer for typing different subtypes of non-small cell lung cancer and a method for screening the same. The aptamer provided by the invention is any DNA segment of nucleotide expressed by sequence 1 to sequence 9 in a sequence table. The aptamer is applied for typing different subtypes of non-small cell lung cancer. The aptamer of the invention can differentiate the different subtypes of non-small cell lung cancer on the molecule response signal under the condition of not knowing tumor markers of the non-small cell lung cancer. Using the aptamer of the invention for identifying the combined target is good for discovering the tumor markers of the different subtypes of non-small cell lung cancer, and earlier and exactly diagnosing and typing non-small cell lung cancer and discovering the tumor for treating new drug action targets.
Owner:INST OF CHEM CHINESE ACAD OF SCI

Marine bacillus and its polypeptide with antitumor activity

The invention relates to a marine bacillus and its polypeptide with antitumor activity. The strain is preserved at China Center for Type Culture Collection in Wuhan, and its preservation number is CCTCC M 2013063. A novel marine bacillus polypeptide with anti-tumor activity is obtained from a fermentation product of the strain. By means of an MTT method, the invention finds that the polypeptide has an obvious proliferation inhibition effect on human hepatoma carcinoma cell BEL-7402, human breast cancer cell MCF-7, human glioma cell U251, human non-small-cell lung cancer cell A549 and other tumor cells, has relatively small cytotoxicity on human fibroblast HFL1, and can be applied in drugs treating human liver cancer, gliomas, lung cancer and breast cancer.
Owner:YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI