Unlock instant, AI-driven research and patent intelligence for your innovation.

Pseudomonas fluorescens as well as method for preparing hydroxamic acid type iron carrier by utilizing pseudomonas fluorescens and application thereof

A technology of Pseudomonas fluorescens and hydroxamic acid, which is applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc., to achieve the effects of rapid bacterial reproduction and growth, low repair cost, and reduced organic matter content

Active Publication Date: 2021-04-30
XIANGTAN UNIV
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the defects in the remediation process of contaminated soil such as heavy metals, polycyclic aromatic hydrocarbons and petroleum hydrocarbons in the prior art, the first purpose of the present invention is to provide a fluorescent Pseudomonas fluorescens strainHMP01 (Pseudomonas fluorescens strainHMP01), Pseudomonas fluorescens can metabolize and produce special hydroxamic acid-type siderophores during the culture process, which can be used for the efficient removal of complex contaminated soils such as heavy metals, polycyclic aromatic hydrocarbons, and petroleum hydrocarbons. repair

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudomonas fluorescens as well as method for preparing hydroxamic acid type iron carrier by utilizing pseudomonas fluorescens and application thereof
  • Pseudomonas fluorescens as well as method for preparing hydroxamic acid type iron carrier by utilizing pseudomonas fluorescens and application thereof
  • Pseudomonas fluorescens as well as method for preparing hydroxamic acid type iron carrier by utilizing pseudomonas fluorescens and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] 16S rDNA gene sequence of Pseudomonas fluorescens strain HMP01 Features:

[0050] The bacterial genome DNA of the bacterial strain is extracted, and the 16SrDNA gene of the bacterial strain is amplified with universal primers 27F and 1492R using the genomic DNA of the bacterial strain as a template. The 16S rDNA product amplified by PCR was sent to Shanghai Bioengineering Co., Ltd. for sequencing. Sequencing results showed that the 16S rDNA partial sequence length of the strain was 1307bp, and its sequence characteristics were as follows:

[0051] CTAGGAATCTGCCTGGTAGTGGGGGATAACGTCCGGAAACGGGCGCTAATACCGCATAC GTCCTGAGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCG GATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGA GGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGT GGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCT GTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAAT ACGAAGGGTGCAA...

Embodiment 2

[0055] Calculation of the binding ratio of heavy metals to hydroxamic acid type siderophore:

[0056] In the first step, take the siderophore with a concentration of 20 mg / L after purification and place it in a brown glass bottle, add Cd 2+ To the final concentration of 0, 0.001, 0.01, 0.05, 0.1, 0.5, 1, 2, 20, 100, 200, 300, 400, 500mg / L, 25ml constant volume, shake and mix for 30min, use a fluorescence spectrophotometer to measure Its maximum emission wavelength and its corresponding fluorescence intensity under the excitation wavelength of 400nm.

[0057] In the second step, on Cd 2+ Concentrations are 0, 0.001, 0.01, 0.05, 0.1, 0.5, 1, 2, 20, 100, 200, 300, 400, 500mg / L, and Cd 2+ The siderophore concentration is the abscissa, and the fluorescence intensity is the ordinate, draw a dotted line graph, and find the inflection point of the change to be 2 mg / L.

[0058] The third step, according to 1molCd 2+ Generate the reaction equation of 1mol complex with nmol sideropho...

Embodiment 3

[0060] Removal of heavy metals in soil polluted by chromium slag factories, soil polluted by pesticide factories, soil polluted by petrochemical industry, soil polluted by heavy metals in vegetable gardens, and soil polluted by heavy metal polycyclic aromatic hydrocarbons in paddy fields by biological eluents:

[0061] The soils used in the experiment were all collected in the field, among them, five kinds of soils, including chromium slag factory polluted soil, pesticide factory polluted soil, petrochemical polluted soil, heavy metal polluted vegetable soil, and heavy metal polycyclic aromatic hydrocarbon complex polluted paddy soil, contained Cd 2+ , Zn 2+ Both exceeded the standard, Cd 2 + Concentrations were 1.17, 1.30, 0.89, 1.13, 0.81mg / kg, Zn 2+ The concentrations were 464.81, 485.26, 326.24, 509.25, 475.91 mg / kg respectively. The pH values ​​of the five soils were 7.56, 6.61, 6.18, 6.93, and 6.71, respectively.

[0062] In the first step, the soil to be washed is n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses pseudomonas fluorescens as well as a method for preparing a hydroxamic acid type iron carrier by utilizing the pseudomonas fluorescens and an application thereof. According to the invention, the hydroxamic acid type iron carrier is generated by utilizing the culture process of Pseudomonas fluorescens fluorescens strain HMP01, and the hydroxamic acid type iron carrier has a chelating effect on heavy metals, and has a solubilizing effect on organic matters, cationic heavy metals, polycyclic aromatic hydrocarbons, petroleum hydrocarbons and composite pollutants thereof in weakly acidic, neutral and weakly alkaline soil of agricultural lands, industrial and mining areas, oil production areas and the like can be efficiently removed in an ex-situ leaching or in-situ leaching mode, and the hydroxamic acid type iron carrier is simple in preparation process, low in cost, high in leaching efficiency and free of secondary pollution.

Description

technical field [0001] The present invention relates to a kind of Pseudomonas fluorescens, and also relates to a method for producing hydroxamic acid siderophores during the cultivation process of Pseudomonas fluorescens, and the application of hydroxamic acid siderophores in the remediation of heavy metal, organic and composite polluted soil It can realize ex-situ leaching or in-situ leaching of cationic heavy metal ions such as cadmium, lead, copper, nickel, zinc, mercury, polycyclic aromatic hydrocarbons, total petroleum hydrocarbons and their complex pollutants in polluted soil on site or agricultural land It belongs to the field of contaminated soil remediation. Background technique [0002] At present, soil pollution in agricultural land, industrial enterprises and other sites is serious, and the characteristic pollutants are inorganic pollutants represented by heavy metals such as cadmium and organic pollutants represented by polycyclic aromatic hydrocarbons. Accordi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12P17/18B09C1/08C12R1/39
CPCC12P17/182B09C1/08
Inventor 李峰易盛炜葛飞田江刘兴旺武晨史恭林刘锐
Owner XIANGTAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More