Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of cytochrome p450 monooxygenase mutant and its application

A monooxygenase and cytochrome technology, applied in the field of enzyme engineering, can solve the problems of unsuitable industrial production of ursodeoxycholic acid, low product concentration, cumbersome steps, etc., and achieve good industrial application development prospects and stable catalytic effect , the effect of high catalytic activity

Active Publication Date: 2022-03-01
JIANGNAN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the above method is limited to the laboratory scale, and there are defects such as low hydroxylase activity, low product concentration, cumbersome steps and poor thermal stability of the enzyme, so it is not suitable for industrial production of ursodeoxycholic acid.
Therefore, it is of great significance to screen cytochrome P450 monooxygenases with high activity and high product concentration in a short period of time to meet the needs of industrial production of ursodeoxycholic acid. A cytochrome P450 monooxygenase that catalyzes the production of ursodeoxycholic acid from lithocholic acid. The concentration of the substrate lithocholic acid reaches 50mmol / L. After 24 hours of reaction, the molar yield of the product is 95.9%, and the optical purity is 99% (R) , but the substrate concentration is still not up to the requirements of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of cytochrome p450 monooxygenase mutant and its application
  • A kind of cytochrome p450 monooxygenase mutant and its application
  • A kind of cytochrome p450 monooxygenase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Construction of Cytochrome P450 Monooxygenase L84Q / D93A

[0026] Based on the cytochrome P450 monooxygenase CYP of Allokutzneria albata as a template (accession number: SDN52915.1), the primers for site-directed mutagenesis were designed as follows (SEQ ID NO.3-4):

[0027] L84Q / D93A-F:

[0028] ACGCCGCTGCCG CAG GACCCCGAAGGCATCCTGGGCATG GCC GCGCCCGA

[0029] L84Q / D93A-R:

[0030] TCGGGCGC GGC CATGCCCAGGATGCCTTCGGGGTC CTG CGGCAGCGGCGT

[0031] Wherein, the underline indicates the mutant sequence.

[0032] Using the recombinant plasmid pET28a-CYP containing I. albicans P450 monooxygenase as a template, the whole plasmid was amplified by PCR. The PCR system is: 1 μL (0.3 μmol / L) of each upstream primer and downstream primer, 1 μL (0.1 μg) of pET28a-CYP template, 5.0 μL of dNTP, Mg 2+ 3.0 μL, PrimeStar Buffer 5.0 μL, PrimeStar DNA Polymerase 1.0 μL, ddH 2 O to make up to 50 μL. The PCR amplification program is: (1) Pre-denaturation at 96°C for 3 min...

Embodiment 2

[0034]Example 2: Preparation of recombinant expression transformant of cytochrome P450 monooxygenase mutant enzyme L84Q / D93A

[0035] The recombinant plasmid pET28a-L84Q / D93A obtained in Example 1 with the cytochrome P450 monooxygenase mutant enzyme L84Q / D93A was retransformed into Escherichia coli E.coli BL21 (DE3) competent cells, and the transformation solution Spread it on LB plate containing kanamycin, culture it upside down at 37°C overnight, and obtain the positive recombinant transformant Escherichia coli BL21(DE3) / pET28a-L84Q / D93A, colony PCR and gene sequencing verification Positive clone.

Embodiment 3

[0036] Example 3: Expression of Cytochrome P450 Monooxygenase Mutant Enzyme L84Q / D93A

[0037] The cytochrome P450 monooxygenase mutated enzyme L84Q / D93A recombinant expression transformant that embodiment 2 gained is inoculated to the LB medium containing kanamycin (peptone 10g / L, yeast extract 5g / L, NaCl 10g / L , pH7.0), 37 ° C shaking culture overnight, according to the inoculation amount of 1% (v / v) into a 500 mL Erlenmeyer flask equipped with 100 mL LB medium, placed at 37 ° C, 180 rpm shaking culture, When the OD of the culture medium 600 When it reaches 0.6, add IPTG with a final concentration of 0.2mmol / L as an inducer, and after induction at 25°C for 12 hours, centrifuge the culture medium, collect the cells, and wash twice with normal saline to obtain resting cells, which can be obtained by freeze-drying for 24 hours Cells were freeze-dried and stored at 4°C after collection. The obtained quiescent cells can also be suspended in a pH7.0 buffer, ultrasonically brok...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
boiling pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a cytochrome P450 monooxygenase mutant and application thereof. The cytochrome P450 monooxygenase mutant L84Q / D93A provided by the present invention has a hydroxylation activity of 5.6 U / mg to lithocholic acid, which is 42.4 times that of the wild-type CYP activity, and has higher catalytic activity and stable catalytic effect , as the substrate concentration increased to 500mmol / L, L84Q / D93A could still completely convert lithocholic acid in 24h. Therefore, the cytochrome P450 monooxygenase and its gene of the present invention have very good prospects for industrial application and development.

Description

technical field [0001] The invention relates to the technical field of enzyme engineering, in particular to a cytochrome P450 monooxygenase mutant and application thereof. Background technique [0002] Ursodeoxycholic acid (UDCA), chemically named 3a,7β-dihydroxy-5β-cholestane-24-acid, is a white powdery solid with the molecular formula C 24 h 40 o 4 , the molecular weight is 392.57, the CAS number is 128-13-2, the melting point is 203°C, the boiling point is 547°C, almost insoluble in water. [0003] Ursodeoxycholic acid has been widely used in the field of medicine for the treatment of gallstones, cholestatic liver disease, fatty liver, various types of hepatitis, toxic liver disorders, cholecystitis, cholangitis and biliary dyspepsia, bile return Flu gastritis, eye diseases, etc. The synthesis of ursodeoxycholic acid has two kinds of chemical method and biological method. Among them, the chemical synthesis method generally adopts seven-step synthesis starting from ch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/70C12P33/00C12P33/06C12N1/21C12R1/19
CPCC12N9/0081C12N15/70C12P33/00C12P33/06C12Y114/15006
Inventor 石金田许国超贾煊杰倪晔郑香玉
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com