A kind of cytochrome p450 monooxygenase mutant and its application
A monooxygenase and cytochrome technology, applied in the field of enzyme engineering, can solve the problems of unsuitable industrial production of ursodeoxycholic acid, low product concentration, cumbersome steps, etc., and achieve good industrial application development prospects and stable catalytic effect , the effect of high catalytic activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Construction of Cytochrome P450 Monooxygenase L84Q / D93A
[0026] Based on the cytochrome P450 monooxygenase CYP of Allokutzneria albata as a template (accession number: SDN52915.1), the primers for site-directed mutagenesis were designed as follows (SEQ ID NO.3-4):
[0027] L84Q / D93A-F:
[0028] ACGCCGCTGCCG CAG GACCCCGAAGGCATCCTGGGCATG GCC GCGCCCGA
[0029] L84Q / D93A-R:
[0030] TCGGGCGC GGC CATGCCCAGGATGCCTTCGGGGTC CTG CGGCAGCGGCGT
[0031] Wherein, the underline indicates the mutant sequence.
[0032] Using the recombinant plasmid pET28a-CYP containing I. albicans P450 monooxygenase as a template, the whole plasmid was amplified by PCR. The PCR system is: 1 μL (0.3 μmol / L) of each upstream primer and downstream primer, 1 μL (0.1 μg) of pET28a-CYP template, 5.0 μL of dNTP, Mg 2+ 3.0 μL, PrimeStar Buffer 5.0 μL, PrimeStar DNA Polymerase 1.0 μL, ddH 2 O to make up to 50 μL. The PCR amplification program is: (1) Pre-denaturation at 96°C for 3 min...
Embodiment 2
[0034]Example 2: Preparation of recombinant expression transformant of cytochrome P450 monooxygenase mutant enzyme L84Q / D93A
[0035] The recombinant plasmid pET28a-L84Q / D93A obtained in Example 1 with the cytochrome P450 monooxygenase mutant enzyme L84Q / D93A was retransformed into Escherichia coli E.coli BL21 (DE3) competent cells, and the transformation solution Spread it on LB plate containing kanamycin, culture it upside down at 37°C overnight, and obtain the positive recombinant transformant Escherichia coli BL21(DE3) / pET28a-L84Q / D93A, colony PCR and gene sequencing verification Positive clone.
Embodiment 3
[0036] Example 3: Expression of Cytochrome P450 Monooxygenase Mutant Enzyme L84Q / D93A
[0037] The cytochrome P450 monooxygenase mutated enzyme L84Q / D93A recombinant expression transformant that embodiment 2 gained is inoculated to the LB medium containing kanamycin (peptone 10g / L, yeast extract 5g / L, NaCl 10g / L , pH7.0), 37 ° C shaking culture overnight, according to the inoculation amount of 1% (v / v) into a 500 mL Erlenmeyer flask equipped with 100 mL LB medium, placed at 37 ° C, 180 rpm shaking culture, When the OD of the culture medium 600 When it reaches 0.6, add IPTG with a final concentration of 0.2mmol / L as an inducer, and after induction at 25°C for 12 hours, centrifuge the culture medium, collect the cells, and wash twice with normal saline to obtain resting cells, which can be obtained by freeze-drying for 24 hours Cells were freeze-dried and stored at 4°C after collection. The obtained quiescent cells can also be suspended in a pH7.0 buffer, ultrasonically brok...
PUM
Property | Measurement | Unit |
---|---|---|
melting point | aaaaa | aaaaa |
boiling point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com