Genetic engineering strain for producing ergothioneine and construction method thereof as well as application

A technology of genetically engineered strains and construction methods, applied in the field of biosynthesis, can solve the problem of lack of genetically engineered bacteria with high ergothioneine production, achieve good transformation and application prospects, and enhance the effect of EGT ability

Pending Publication Date: 2021-06-18
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The object of the present invention is to provide a kind of genetically engineered bacterial strain for producing ergothioneine and its construction method and application, thus solve the problem that prior art lacks the problem of the genetically engineered bacterium of high yield ergothioneine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering strain for producing ergothioneine and construction method thereof as well as application
  • Genetic engineering strain for producing ergothioneine and construction method thereof as well as application
  • Genetic engineering strain for producing ergothioneine and construction method thereof as well as application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Construction of a strain with Mn_hal gene deletion

[0042] Our research found that Mycobacterium neoaureus will further decompose EGT under the condition of oversynthesizing EGT, indicating that the bacterium has an EGT decomposition pathway to regulate the physiological level of EGT in the cell. The existence of this degradation system prevents EGT from high levels. Accumulation limits the development of engineering bacteria. Therefore, we analyzed and screened the suspected genes in Mycobacterium neoaureus, and found that a gene named Hal, inactivating it, can significantly prevent the catabolism of EGT, and can effectively guarantee the high-level accumulation of EGT. Hal is a histidine ammonia lyase, also known as histidase and histidine deaminase, which can catalyze the deamination of histidine to generate urocanic acid. It is surprising that some isozymes of Hal are not With the function of Hal, the inactivation of its isoenzymes cannot prevent the de...

Embodiment 2

[0067] Embodiment 2: Construction of Mn_hisC gene copy number increased bacterial strain

[0068] By comparing the transcriptome differences between Mn-egtABCDE-hisG and Mn strains, we found that in the Mn-egtABCDE-hisG strain with higher EGT production, the transcription level of the gene hisC encoding histidinol phosphate aminotransferase was increased compared with the starting strain Mn Nearly 2.2 times. Since HisC is one of the catalytic enzymes of the histidine precursor synthesis pathway required for the synthesis of EGT, we believe that by increasing the copy number of hisC, it is likely that the yield of EGT will be significantly improved.

[0069] The Mn_hisC gene sequence of Mycobacterium aureus has been uploaded to the NCBI database, GeneBank accessionnumber: NZ_JMDW01000010.1; Region: 275183...274053, the specific sequence is as follows:

[0070] GTGAGTGCGGCCAAGATCACCCTCGACGACCTGCCGTTGCGCGACAGCCTGCGCGG CAAATCCCCCTACGGCGCACCACAACTGGCGGTGCCGGTGCGGCTGAACACCAACG AGAA...

Embodiment 3

[0078] Embodiment 3: Construction of Mn_hisC-Mn_allB1 co-expression strain

[0079] When comparing the transcriptome differences between Mn-egtABCDE-hisG and Mn strains, we found that the transcript level of the allantoinase gene allB1 was relatively increased by 10.5 times in the Mn-egtABCDE-hisG strain with higher EGT production. Therefore, we tried to increase the production of EGT by increasing the copy number of allB1.

[0080] The sequence of the Mn_allB1 gene of Mycobacterium neoaureus has been uploaded to the NCBI database, GeneBank accessionnumber: NZ_JMDW01000001.1; Region: 147070...146582, the specific sequence is as follows:

[0081] GTGTTGCTGCATCAGGGAATCGGACTGGACGTGTTCAACGCGTTGCCCGAACGCAA GGCCGTACACGCGCTCTACGAGTGCTGCAACAGCTATGCGCTGGCCCGCGAACTCGT CCGTGGCCGCCCTTATCCCGATCACGACGCACTGTTCCGCCGCGCCGATGCCGCGCT GTTCGAGCTGCCCGAATCCGCCGTGGATCAGATCCTGGACGCGTGCCCCGATATCGG CAGGCGACCGCGCAGCGCGAAGTCGCAGGCCGAACCCTGTGCGGTCTGGGATGACG ATGCCGAATTGATGGCAGCGCTGAGCGCCGCCTCCCGGCAGTACGCGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic engineering strain for producing ergothioneine and a construction method thereof as well as application. The construction of the genetic engineering strain comprises the following steps of A, introducing a suicide plasmid p19-Mn_hal into a competent state of a Mn-egtABCDE-hisG strain through electric transformation, and carrying out PCR amplification screening by utilizing a homologous arm primer, so as to obtain a Mn[delta]hal-egtABCDE-hisG strain; and B, introducing an integrated plasmid pMV306-Mn_hisC-Mn_allB1 into a competent state of the Mn[delta]hal-egtABCDE-hisG through electric transformation, and carrying out plate screening and verification, thereby obtaining the genetic engineering strain. Metabolic engineering transformation is carried out on a mycobacterium neoaurum capable of generating the ergothioneine, the ergothioneine production capacity of the constructed genetic engineering strain is improved by 18 times compared with that of a wild type strain and is improved by 4.1 times compared with that of an original strain, and the genetic engineering strain has a good application prospect.

Description

technical field [0001] The invention relates to the field of biosynthesis applications, in particular to a genetically engineered bacterial strain for producing ergothioneine and its construction method and application. [0002] technical background [0003] Ergothioneine (EGT), also known as Thiolhistidine-betaine, scientific name 2-mercaptohistidine trimethyl inner salt, is the only known natural 2-thioimidazole amino acid. EGT can be biosynthesized by mushroom fungi, Neurospora crassa and cyanobacteria, but no animal or plant has been found to have the ability to synthesize EGT. EGT has the functions of cell redox, signal transduction and bioenergy homeostasis, and is considered to be an important factor in prolonging health and delaying aging. Appropriate supplementation can significantly reduce the risk of chronic diseases and premature aging in middle-aged and elderly people. The heterotrophic human body mainly relies on the intake of ergothioneine from the daily diet,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12N15/31C12P13/04C12R1/32
CPCC12N15/74C07K14/35C12P13/04Y02A50/30
Inventor王风清谢智勇魏东芝克洁陶欣艺赵明熊亮斌
OwnerEAST CHINA UNIV OF SCI & TECH