Genetic engineering strain for producing ergothioneine and construction method thereof as well as application
A technology of genetically engineered strains and construction methods, applied in the field of biosynthesis, can solve the problem of lack of genetically engineered bacteria with high ergothioneine production, achieve good transformation and application prospects, and enhance the effect of EGT ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1: Construction of a strain with Mn_hal gene deletion
[0042] Our research found that Mycobacterium neoaureus will further decompose EGT under the condition of oversynthesizing EGT, indicating that the bacterium has an EGT decomposition pathway to regulate the physiological level of EGT in the cell. The existence of this degradation system prevents EGT from high levels. Accumulation limits the development of engineering bacteria. Therefore, we analyzed and screened the suspected genes in Mycobacterium neoaureus, and found that a gene named Hal, inactivating it, can significantly prevent the catabolism of EGT, and can effectively guarantee the high-level accumulation of EGT. Hal is a histidine ammonia lyase, also known as histidase and histidine deaminase, which can catalyze the deamination of histidine to generate urocanic acid. It is surprising that some isozymes of Hal are not With the function of Hal, the inactivation of its isoenzymes cannot prevent the de...
Embodiment 2
[0067] Embodiment 2: Construction of Mn_hisC gene copy number increased bacterial strain
[0068] By comparing the transcriptome differences between Mn-egtABCDE-hisG and Mn strains, we found that in the Mn-egtABCDE-hisG strain with higher EGT production, the transcription level of the gene hisC encoding histidinol phosphate aminotransferase was increased compared with the starting strain Mn Nearly 2.2 times. Since HisC is one of the catalytic enzymes of the histidine precursor synthesis pathway required for the synthesis of EGT, we believe that by increasing the copy number of hisC, it is likely that the yield of EGT will be significantly improved.
[0069] The Mn_hisC gene sequence of Mycobacterium aureus has been uploaded to the NCBI database, GeneBank accessionnumber: NZ_JMDW01000010.1; Region: 275183...274053, the specific sequence is as follows:
[0070] GTGAGTGCGGCCAAGATCACCCTCGACGACCTGCCGTTGCGCGACAGCCTGCGCGG CAAATCCCCCTACGGCGCACCACAACTGGCGGTGCCGGTGCGGCTGAACACCAACG AGAA...
Embodiment 3
[0078] Embodiment 3: Construction of Mn_hisC-Mn_allB1 co-expression strain
[0079] When comparing the transcriptome differences between Mn-egtABCDE-hisG and Mn strains, we found that the transcript level of the allantoinase gene allB1 was relatively increased by 10.5 times in the Mn-egtABCDE-hisG strain with higher EGT production. Therefore, we tried to increase the production of EGT by increasing the copy number of allB1.
[0080] The sequence of the Mn_allB1 gene of Mycobacterium neoaureus has been uploaded to the NCBI database, GeneBank accessionnumber: NZ_JMDW01000001.1; Region: 147070...146582, the specific sequence is as follows:
[0081] GTGTTGCTGCATCAGGGAATCGGACTGGACGTGTTCAACGCGTTGCCCGAACGCAA GGCCGTACACGCGCTCTACGAGTGCTGCAACAGCTATGCGCTGGCCCGCGAACTCGT CCGTGGCCGCCCTTATCCCGATCACGACGCACTGTTCCGCCGCGCCGATGCCGCGCT GTTCGAGCTGCCCGAATCCGCCGTGGATCAGATCCTGGACGCGTGCCCCGATATCGG CAGGCGACCGCGCAGCGCGAAGTCGCAGGCCGAACCCTGTGCGGTCTGGGATGACG ATGCCGAATTGATGGCAGCGCTGAGCGCCGCCTCCCGGCAGTACGCGCA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



