Replication-defective canine parvovirus packaging vector, replication-defective recombinant canine parvovirus as well as preparation and application
A canine parvovirus, replication-deficient technology, applied in the field of vaccines, can solve the problems of small genome, limit the practical application of CPV-2 virus vector, and cannot accommodate genome fragments, etc., and achieve high safety effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Construction method of vector ITR plasmid pITR-P-EGFP-TS-ITR
[0049] (1) Extraction of canine parvovirus New CPV-2a subtype strain CPV-BM isolated from Guangzhou area (Qian Peng. Isolation and identification of canine and feline parvovirus in Guangzhou area, genetic evolution analysis and establishment of TaqMan probe fluorescence quantitative method [D]. South China Agricultural University, 2018.) DNA, the obtained DNA samples were sent to Huada Gene Technology Co., Ltd. for whole genome sequencing and splicing; the ITR sequences at both ends of the genome were obtained from the whole genome, and the 3' end ITR The ITR sequence at the 5' end and the 5' end are as follows, and a multiple cloning site region is added between the two: CTCGAGGGGCCCGCGGCCGCGGATCC; the sequence is handed over to Jinweizhi Biotechnology Co., Ltd. for artificial synthesis, and the two ends are respectively added with restriction sites Kpn I and Sac I , inserted into the plasmid pBlu...
Embodiment 2
[0067] Example 2 Construction method of helper plasmid pCPV-NS-VP
[0068] Using canine parvovirus New CPV-2a subtype strain CPV-BM to infect F81 cat kidney cells (purchased from Wuhan Punuosai Life Technology Co., Ltd.) for 48 hours, the DNA extracted was used as a template, and primers CPV2-NSVP-F and CPV2- NSVP-R performs PCR amplification of the NS-VP gene. The PCR reaction system is: 5 μL of 10×PCR Buffer, 7 μL of 2mM dNTPs, 1 μL of each 20 μM primer, 1 μL of DNA template, 1 μL of KOD high-fidelity enzyme, ddH 2 O 34 μL; PCR reaction conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 68°C for 2 min and 30 s, 32 cycles; final extension at 68°C for 5 min; PCR products were cut after agarose gel electrophoresis The specific band of about 4700bp on the gel was used to recover the amplified product fragment using the gel recovery kit, and it was restricted with the plasmid pBluescript II SK (+) (purchased fro...
Embodiment 3
[0073] Example 3 Carrier ITR plasmid pITR-P-EGFP-TS-ITR transfection cell experiment
[0074] The carrier ITR plasmid pITR-P-EGFP-TS-ITR prepared in Example 1 was transfected into F81 cat kidney cells for analysis of the expression of green fluorescent protein (EGFP). The specific steps of transient transfection of cells are as follows:
[0075] ① F81 cat kidney cell plating: use 5 mL of DMEM containing 10% (v / v) fetal bovine serum (fetal bovine serum, FBS) to blow away the F81 cat kidney cells, take 450 μL / well of cells, and wait for the cells to grow to a confluence of 70~ 80% for transfection;
[0076] ② When performing transfection, replace 1 mL of serum-free DMEM medium without antibiotics shortly before adding the liposome / DNA mixture;
[0077] ③ Prepare solution A (Opti-MEM Medium 62.5 μL, Lipofectamine 3000 Reagent 2.8125 μL) and solution B (Opti-MEM Medium 62.5 μL, P3000 Reagent 2.5 μL, plasmid pITR-P-EGFP-TS-ITR1.25 μg); -MEM Medium, Lipofectamine 3000 Reagent, P30...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More