Unlock instant, AI-driven research and patent intelligence for your innovation.

Mesothelin-ODC422-461 fusion protein expressed by DCs (dendritic cells) and application of mesothelin-ODC422-461 fusion protein

A fusion protein and cell technology, which is applied in the direction of fusion polypeptide, animal cells, cell culture active agents, etc., can solve the problems of immunity and antigenicity differences, achieve short half-life, improve antigen presentation efficiency, and have little toxicity and side effects.

Pending Publication Date: 2021-12-07
赛元生物科技(杭州)有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a tumor-associated antigen, mesothelin antigens have differences in their immunity and antigenicity. Some cannot efficiently stimulate T cells to generate an immune response, and some are difficult to combine with T cells and cannot be effectively presented

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mesothelin-ODC422-461 fusion protein expressed by DCs (dendritic cells) and application of mesothelin-ODC422-461 fusion protein
  • Mesothelin-ODC422-461 fusion protein expressed by DCs (dendritic cells) and application of mesothelin-ODC422-461 fusion protein
  • Mesothelin-ODC422-461 fusion protein expressed by DCs (dendritic cells) and application of mesothelin-ODC422-461 fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1. The source of Mesothelin Use the primer pair Mesothelin EcoRI F (TTCAGGTGTCGTGATTCGAATTCATGGCCTTGCCAACGGCTCG) (SEQ ID NO.4) and Mesothelin BamHI R (AGGCTGCCTCTGCCCTCGGATCCTCAGGCCAGGGTGGAGGCTAGGA) (SEQ ID NO.5) to amplify the MSLN CDS sequence (SEQ ID NO.5) from human cNDA .6).

[0045] The PCR amplification conditions are:

[0046] I-5TM 2X High-Fidelity Master Mix: 12.5ul

[0047] 10uM Mesothelin EcoRIF: 0.75ul

[0048] 10uM Mesothelin BamHIR: 0.75ul

[0049] Human cDNA: 250ng

[0050] ddH2O: up to 25ul

[0051] The amplification program was: 98°C for 3 min; 98°C for 10 s, 56°C for 10 s, and 72°C for 10 s, a total of 30 cycles.

[0052] And purified and recovered; TOPO connected MSLN CDS sequence and pClone007 Versatile Simple Vector (Qingke Bio, cat.007VS), transformed into DH5α Escherichia coli competent, coated with ampicillin (Amp) resistant LB plate, picked single clone colony, Enzyme digestion and sequencing verification.

[0053] Pick 12 monocl...

Embodiment 2

[0055] The construction of embodiment 2.MSLN-ODC1425-461 eukaryotic expression vector:

[0056] PEST sequences rich in proline, glutamic acid, serine, and threonine are associated with rapid protein degradation. We used ePESTFind (http: / / www.bioinformatics.nl / cgi-bin / emboss / epestfind) to detect MSLN protein Analysis was performed and no potential PEST sequences were found. After the MSLN antigen is produced in the cell, although it can be degraded into small molecular peptides by the proteasome present in the cytoplasm, its half-life is longer. In order to reduce its half-life, we fused the ODC1425-461 sequence (SEQ ID NO.9) to the C-terminus of the MSLN protein to construct a vector pCO26, while pCO32 was used as a control without the ODC1425-461 sequence.

[0057] The experimental vector pCO26 was constructed using the vector pCO13 in our laboratory as a template, and the primer pair pCO26-F (CCATTTCAGGTGTCGTGATTCGAATTCGCCACCATGGCCTCCTCCG) (SEQ ID NO.10) and pCO26-R (GTCGAG...

Embodiment 3

[0075]Example 3. In vivo expression identification of MSLN fusion protein The vectors pCO26 and pCO32 constructed above were transfected into HEK293 T cells using the transfection reagent lipo2000, and the cells were visually detected 24 hours later. The experimental method is as follows:

[0076] Transfection: The day before the experiment, use the automatic cell counter Countstar-IC1000 and its supporting software CountStar BioTech to count the HEK293 cells, inoculate 2×105 cells / well in a 12-well plate, and culture the cells at 37°C and 5% CO2 Incubate overnight in the box. 30 minutes before transfection, replace the medium with fresh DMEM medium containing 5% FBS, 1 mL per well. For transfection, take 1.6 μg of the corresponding plasmid from each transfection well, add it to 300 μL of FBS-free reduced serum DMEM medium, mix well, add 4.0 μL of transfection reagent, mix gently, and place at room temperature for 18 minutes. Gently drop the mixture of plasmid and transfecti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mesothelin-ODC422-461 fusion protein expressed by DCs (dendritic cells) and application of the mesothelin-ODC422-461 fusion protein. The fusion protein is a protein consisting of an amino acid sequence as shown in SEQ ID NO. 1, and is formed by fusing the mesothelin protein and amino acid at site C-422-461 of mouse ornithine decarboxylase, and the DCs are derived from DCs differentiated from monocyte in PBMCs, DCs differentiated from iPS / ES induction, and primary DC cells separated from blood. The fusion protein can be used for inducible expression in DC cells, tumor antigen presentation of the DCs is facilitated, the antigen presentation efficiency of in-vivo T cells is improved, the T cells are activated to kill tumor cells, and in addition, the fusion protein can be used for cell therapy since the half-life period of the fusion protein is very short, the fusion protein serving as medicine has small toxicity and small side effects, and can generate synergistic effects with immune cells.

Description

technical field [0001] The invention belongs to the field of biological genes, in particular to a mesothelin-ODC422-461 fusion protein expressed by DC cells and its application. Background technique [0002] In tumor treatment, due to the tumor microenvironment and the immunosuppressive state caused by tumors, it is difficult for the immune system to recognize tumor antigens and effectively present antigens. The degradation of tumor antigens can enhance the immunogenicity of tumor antigens and activate the patient's own immune system. The immune system induces the body's cellular and humoral immune responses, so as to achieve the purpose of eradicating tumors. [0003] In the past tumor vaccine research, by activating the patient's own immune system, using tumor cells or tumor antigen substances to induce the body's specific cellular immunity and humoral immune response, enhance the body's anti-cancer ability, and prevent the growth, spread and recurrence of tumors, in order...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K14/705C07K14/47C12N9/88C12N15/867C12N15/65C12N5/10C12Q1/6851G01N15/14G01N21/64
CPCC12N9/88C07K14/70525C07K14/4748C12N15/86C12N15/65C12N5/0696C12N5/0639C12Q1/6851G01N15/14G01N21/6428C12Y401/01017C07K2319/00C12N2740/15043C12N2506/45C12N2501/2304C12N2501/22C12N2500/50C12N2510/00G01N2015/1488C12Q2531/113C12Q2563/107
Inventor 戴滨阳张进茹欢委
Owner 赛元生物科技(杭州)有限公司