Unlock instant, AI-driven research and patent intelligence for your innovation.

Tetracycline antibiotic degrading bacterium at low temperature and application thereof

A technology of tetracyclines and degrading bacteria, applied in the fields of applications, bacteria, microorganisms, etc.

Pending Publication Date: 2022-01-28
SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, most studies only focus on the degradation of oxytetracycline at medium and high temperatures, and there are few studies on the degradation of oxytetracycline at low temperature, but low temperature can inhibit the degradation of antibiotics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tetracycline antibiotic degrading bacterium at low temperature and application thereof
  • Tetracycline antibiotic degrading bacterium at low temperature and application thereof
  • Tetracycline antibiotic degrading bacterium at low temperature and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Isolation of Pseudomonas putida

[0036] It is obtained from the soil of a livestock and poultry farm in Shenbei New District, Shenyang City, Liaoning Province through enrichment, separation and purification. Specifically, the following steps are included:

[0037] Step 1: Enrichment of strains

[0038] Weigh 5g of soil and add it to 250mL enrichment medium, which contains 20mg / L oxytetracycline, and incubate in the dark at 15°C and 160r / min in a shaker for 7 days. Take 5 mL of enriched culture medium and add it to a new enriched medium to continue culturing according to the above culture conditions, and then transfer again, and the concentration of antibiotics added to the enriched medium for each transfer is increased by 20 mg / L. Repeat the above steps for transfer culture until the concentration of antibiotics in the enriched medium reaches 100 mg / L.

[0039] Step 2: Isolation and purification of strains

[0040] Dilute the enriched culture solution wit...

Embodiment 2

[0047] Embodiment 2: bacterial strain 16S identification

[0048] (1) Genome extraction

[0049] Genomic DNA of strain TU-3 was extracted using the TIANamp Bacteria DNA Kit Bacterial Genomic DNA Extraction Kit from Tiangen Biochemical Technology Co., Ltd. and following the instructions.

[0050] (2) PCR amplification

[0051] The 16S universal primers are: 27F: AGAGTTTGATCCTGGCTCAG 1492R: TACGGCTACCTTGTTACGACTT, and the PCR length is about 1500bp.

[0052] PCR reaction system:

[0053]

[0054] PCR reaction program:

[0055] Pre-denaturation at 95°C for 4min, deformation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 40s, 35 cycles, extension at 72°C for 7min, and 4°C until termination.

[0056] (3) Gel electrophoresis

[0057] Finally, the obtained PCR product was observed by 1% agarose gel electrophoresis, and the electrophoresis condition was 80V for 30min. The PCR products that were successfully amplified were sent to Huada Gene Technology Co., ...

Embodiment 3

[0063] Example 3: Verification of the degradation effect of TU-3 on oxytetracycline

[0064] Shake culture TU-3 in LB medium at 37°C and 160rpm for 24 hours, then inoculate 5% of the inoculum into the selection medium containing oxytetracycline 20 mg per liter, and culture at 5°C and 10°C respectively. And 15 ℃, 160rpm conditions of shaking culture in the dark for 20d, each group set up three parallel, with no bacteria as a blank control. The resulting culture was passed through a 0.22um organic filter, and the residual concentration of oxytetracycline was detected on the machine.

[0065] Calculated as follows:

[0066]

[0067] The results showed that the initial content of oxytetracycline was 20mg / L, and the degradation rate of the bacteria could reach 66.6% in 8 days at 15°C and 160rpm, and the degradation rate of the blank control was 32%; at 10°C and 160rpm, the degradation rate in 20d could reach 45.5%. %, the degradation rate of the blank control is 20%; under the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological treatment of antibiotic pollution, and particularly relates to pseudomonas putida capable of degrading oxytetracycline at low temperature (5-15 DEG C) and application of the pseudomonas putida. The degrading bacterium is gram-negative pseudomonas putida TU-3 which is preserved in the culture collection center of the Institute of Microbiology of Chinese Academy of Sciences on July 22, 2021, and the number of the degrading bacterium is CGMCC (China General Microbiological Culture Collection Center) No. 22940. The strain can be applied to preparation of oxytetracycline degrading bacteria, the strain resources of the oxytetracycline degrading bacteria are enriched, and a scientific basis is provided for degradation of oxytetracycline in soil.

Description

technical field [0001] The invention belongs to the technical field of biological treatment of antibiotic pollution, and in particular relates to a strain of Pseudomonas putida capable of degrading oxytetracycline at low temperature (5°C-15°C) and its application. Background technique [0002] Oxytetracycline is a broad-spectrum semi-synthetic tetracycline antibiotic. It is low in cost and easy to use. It has good antibacterial effect and less side effects and toxicity. It is often used as a veterinary antibiotic for the prevention and treatment of animal diseases. With the development of animal husbandry and aquaculture, the use of oxytetracycline has greatly increased, and it has become a new type of environmental pollutant, facing new environmental problems. [0003] 30%-90% of the antibiotics ingested by livestock and poultry will be excreted through the metabolic system and enter the natural world through rainwater runoff and soil infiltration. When environmental antib...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C09K17/14C02F3/34C12R1/40C02F101/34C02F101/38
CPCC12N1/20C09K17/14C02F3/34C02F2101/34C02F2101/38Y02W10/10
Inventor 张颖张艺赵爽韩斯琴史荣久
Owner SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI