Antarctic ice algae MAAs synthetases as well as coding genes and application thereof

An Antarctic ice algae and coding gene technology, applied in the field of biology, can solve problems such as separation and purification of functional activity and research difficulties in mechanism of action, and achieve the effect of alleviating negative damage, significant significance and huge social benefits

Pending Publication Date: 2022-01-28
OCEAN UNIV OF CHINA +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The content of MAAs synthetase in organisms is extremely small, which makes it extremely difficult to directly isolate and purify MAAs synthetase from organisms and conduct research on its structure, functional activity and mechanism of action.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antarctic ice algae MAAs synthetases as well as coding genes and application thereof
  • Antarctic ice algae MAAs synthetases as well as coding genes and application thereof
  • Antarctic ice algae MAAs synthetases as well as coding genes and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1. The cultivation and whole genome sequencing of Antarctic ice algae

[0055] The total sequencing volume of the Antarctic ice algae genome is 43.76 G, with a coverage depth of 71.07 X. In addition, the second-generation small fragments and 10X Genomic library were constructed and sequenced using the illumina platform. Using the Antarctic ice algae genome 103.70 G sequencing data, the sequencing depth was 168.43 X. The Antarctic ice algae genome was denovo assembled to identify its species.

[0056] The assembly results are as follows: the total length of the contig is 532.13 Mbp, and the contig N50 reaches 209.56 Kbp; the total length of the scaffold is 541.31 Mbp, and the scaffold N50 reaches 490.02 Kbp. It was identified as Antarctic ice algae by bioinformatics Chlamydomonas sp. . ICE-L.

Embodiment 2

[0057] Embodiment 2. Antarctic ice algae Chlamydomonas Acquisition of cDNA sequence of sp. ICE-L MAAs synthetase (MysA, MysB, MysC)

[0058] 1. Extraction of total RNA from Antarctic ice algae

[0059] Using Invitrogen's Trizol reagent to extract Antarctic ice algae cultured to the logarithmic phase at 4°C Chlamydomonas sp. ICE-L RNA. The test was carried out according to the extraction process instructions of Trizol reagent, and no RNase contamination was ensured throughout the process, and the extracted RNA was frozen and stored in a -80°C refrigerator for later use.

[0060] 2. Acquisition of cDNA sequence of MAAs synthetase gene of Antarctic ice algae

[0061] Extract high-quality RNA according to PrimeScript 1 st The strand cDNA Synthesis Kit (TaKaRa) manual was used to perform reverse transcription and synthesize cDNA. The specific operation steps are as follows:

[0062] (1) Mix the following systems evenly:

[0063] Template RNA 0.6 μL

[0064] Oligo dT Pri...

Embodiment 3

[0091] Example 3. Antarctic ice algae Chlamydomonas sp. ICE-L MAAs synthetase gene ( MysA , MysB , MysC ) construction of expression vector and heterologous expression in Escherichia coli

[0092] 1. Design primers according to the complete sequence of the MAAs synthetase gene obtained by sequencing:

[0093] MysAExpression primers:

[0094] MysA -F: ATGTCGTTCCGCCCCAAACT;

[0095] MysA -R:GCAGAAGTGATTCAAAGTCTCCTCC;

[0096] MysB Expression primers:

[0097] MysB- F: ATGCAAGTGTCCCTGAAGGGA;

[0098] MysB- R: CCGTTTTCGGCACAAAGCAA;

[0099] MysC Expression primers:

[0100] MysC- F: ATGCCACTTGGTGGCACTTCC;

[0101] MysC- R: GCTGCCCCCGGCATCCT.

[0102] The PCR reaction conditions were: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 2 min, and repeated 30 cycles.

[0103] 2. Utilize the PCR method to pass the above primers to MysA Add 6×his-tag to the C-terminus of the DNA, optimiz...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses antarctic ice algae MAAs synthetases as well as coding genes and application thereof. The antarctic ice algae MAAs synthetases comprises MysA, MysB and MysC, the amino acid sequences of the MysA, the MysB and the MysC are respectively shown as SEQ ID NO.7, SEQ ID NO.9 and SEQ ID NO.11, and the nucleotide sequences of the coding genes of the MysA, the MysB and the MysC are respectively shown as SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.12. Experiments prove that the coding genes of the three antarctic ice algae MAAs synthetases are cloned and converted into recombinant strains at the same time, the survival rate of the strains in UVB radiation can be effectively increased, the strains can be used for producing MAAs and intermediates thereof, and the produced MAAs has the effect of repairing cell DNA damage and cornea damage caused by ultraviolet radiation and has a high application value.

Description

technical field [0001] The invention relates to the technical field of biology, in particular to an Antarctic ice algae MAAs synthetase and its coding gene and application. Background technique [0002] With the increasingly serious problem of the ozone hole, especially the emergence and expansion of the ozone hole at the north and south poles, the ultraviolet radiation reaching the earth's surface is also becoming more and more intense. Increasing ultraviolet radiation will lead to a sharp increase of reactive oxygen species in organisms, destroy the structure of macromolecules such as proteins and DNA, and cause oxidative damage, which in turn leads to the inhibition of the growth of photosynthetic organisms in aquatic and terrestrial ecosystems. Like other living organisms, exposure to UV radiation in humans can cause damage such as erythematous "sunburn" in the short term, and premature skin aging and skin cancer in the long term, posing serious health risks. At present...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/70C12N1/21A61K8/44A61K31/198A61P17/16A61Q17/04C12R1/19
CPCC12N9/00C12N15/70A61K8/44A61K31/198A61Q17/04A61P17/16
Inventor曹峻菡缪锦来曲长凤何英英张丽萍邓雅姗王静凤
OwnerOCEAN UNIV OF CHINA