Unlock instant, AI-driven research and patent intelligence for your innovation.

HOXA10-expressing human umbilical cord mesenchymal stem cell line as well as preparation method and application thereof

A technology of HOXA10 and mesenchymal stem cells, applied in the field of biomedicine, can solve the problems of poor endometrial injury and achieve effective treatment

Pending Publication Date: 2022-02-01
SHANGHAI EAST HOSPITAL EAST HOSPITAL TONGJI UNIV SCHOOL OF MEDICINE
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the above-mentioned technical problems in the prior art, the present invention provides one and its preparation method and application. The human umbilical cord mesenchymal stem cell line expressing HOXA10 and its preparation method and application should solve the problems in the prior art. The technical problem that the drug is not effective for endometrial injury

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HOXA10-expressing human umbilical cord mesenchymal stem cell line as well as preparation method and application thereof
  • HOXA10-expressing human umbilical cord mesenchymal stem cell line as well as preparation method and application thereof
  • HOXA10-expressing human umbilical cord mesenchymal stem cell line as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0040] Example 2 HOXA10 plasmid preparation and transfection

[0041] (1) Amplify the CDS sequence of HOXA10 from hUCMSCs

[0042] The total RNA of hUCMSCs was extracted with TRIzol-phenol-chloroform one-step method, and the total RNA was extracted according to Takara reverse transcription kit PrimeScript TM RT Reagent Kit instructions reversed into cDNA. The CDS sequence of HOXA10 was obtained from NCBI (NCBI website) ( figure 2), using the primer5 software to design primer sequences with 20 bp homology arms before and after the HindIII restriction site of the pLv-AcGFP vector, the primers were synthesized by Beijing Qingke Biological Company, and the cDNA obtained by reverse transcription of hUCMSCs was used as a template for amplification. The size of the PCR product was detected by agarose gel electrophoresis with a mass percent concentration of 1%, and then recovered.

[0043] The primer sequences are:

[0044] F: ctcaagcttcgaattccaagaaatgtcagccagaaagggcta (SEQ ID N...

Embodiment 3

[0065] Example 3 CKK8 detection of T10-UCMSCs cell line proliferation

[0066] After HOXA10 lentivirus infected UCMSCs, the proliferation of the cell line was detected with CKK8 kit (hanbio). The cells were seeded in a 96-well plate at a density of 5×10^4, and 10 μl of CKK8 solution was sequentially added at intervals of 24 h, 48 h, 96 h and 120 h. Continue to cultivate for 4h, and detect the absorbance with a microplate reader at 450nm ( image 3 ). Each group repeated 3-5 holes and took the average value.

[0067] image 3 It shows the proliferation of UCMSCs of HOXA10 virus and UCMSCs transfected with lentiviral vector.

Embodiment 4

[0068] Example 4 Dual-luciferase reporter assay detects that HOXA10 has function in T10-UCMSCs cell line

[0069] Emx2 and ITGB3 promoters were inserted into pGL3-basic vector (Promega), respectively. Lipofectamine 2000 (Invitrogen) facilitated co-transfection of vector and negative control (pGL3-basic) and reporter vector pRL-SV40 plasmids into 293T cells. 48 hours after transfection, the luciferase activity was detected using the Dual Luciferase Reporter Gene Assay Kit (Promega) ( Figure 4 ).

[0070] Conclusion: HOXA10 has function in T10-UCMSCs cell line.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a HOXA10-expressing human umbilical cord mesenchymal stem cell line as well as preparation method. The sequence of HOXA10 is as shown in SEQ ID NO: 4. The invention also provides a preparation method of the HOXA10-expressing human umbilical cord mesenchymal stem cell line. The preparation method comprises the following steps: amplifying the HOXA10 gene from human umbilical cord mesenchymal stem cells; cloning the obtained HOXA10 gene into a lentiviral vector; and infecting the human umbilical cord mesenchymal stem cells with the lentivirus with the HOXA10 to obtain the HOXA10-expressing human umbilical cord mesenchymal stem cell line . The invention also provides the application of theHOXA10-expressing human umbilical cord mesenchymal stem cell line in preparation of a medicine for treating endometrial injury. The invention finds that the T10-UCMSCs cell line obviously improves the treatment effect of stem cells on repairing endometrial injury, and is greatly helpful for clinical treatment of infertility caused by endometrial injury.

Description

technical field [0001] The invention belongs to the field of biomedicine, and relates to a human umbilical cord mesenchymal stem cell line, specifically a human umbilical cord mesenchymal stem cell line expressing HOXA10, a preparation method and application thereof. Background technique [0002] The uterus is an important physiological organ of women, which maintains women's physiological characteristics and reproductive functions. Among them, the endometrium plays an important role in embryo implantation and pregnancy. Endometrial damage is the main cause of female infertility. [0003] The existing scheme is to transplant UCMSCs into the uterus through the tail vein or the uterine cavity, so as to increase the thickness of the endometrium, alleviate the fibrosis of the damaged part, and achieve the therapeutic effect. [0004] Due to the existence of individual differences, treatment methods such as hormone replacement therapy are not effective, which makes stem cell th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/867C12N15/12C12N15/85C12N7/01A61K35/28A61P15/00
CPCC12N5/0668C12N15/86C07K14/4702C12N15/85C12N7/00C12N5/0686A61K35/28A61P15/00C12N2740/15021C12N2740/15043
Inventor 谢敬吴美贤
Owner SHANGHAI EAST HOSPITAL EAST HOSPITAL TONGJI UNIV SCHOOL OF MEDICINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com