HOXA10-expressing human umbilical cord mesenchymal stem cell line as well as preparation method and application thereof
A technology of HOXA10 and mesenchymal stem cells, applied in the field of biomedicine, can solve the problems of poor endometrial injury and achieve effective treatment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0040] Example 2 HOXA10 plasmid preparation and transfection
[0041] (1) Amplify the CDS sequence of HOXA10 from hUCMSCs
[0042] The total RNA of hUCMSCs was extracted with TRIzol-phenol-chloroform one-step method, and the total RNA was extracted according to Takara reverse transcription kit PrimeScript TM RT Reagent Kit instructions reversed into cDNA. The CDS sequence of HOXA10 was obtained from NCBI (NCBI website) ( figure 2), using the primer5 software to design primer sequences with 20 bp homology arms before and after the HindIII restriction site of the pLv-AcGFP vector, the primers were synthesized by Beijing Qingke Biological Company, and the cDNA obtained by reverse transcription of hUCMSCs was used as a template for amplification. The size of the PCR product was detected by agarose gel electrophoresis with a mass percent concentration of 1%, and then recovered.
[0043] The primer sequences are:
[0044] F: ctcaagcttcgaattccaagaaatgtcagccagaaagggcta (SEQ ID N...
Embodiment 3
[0065] Example 3 CKK8 detection of T10-UCMSCs cell line proliferation
[0066] After HOXA10 lentivirus infected UCMSCs, the proliferation of the cell line was detected with CKK8 kit (hanbio). The cells were seeded in a 96-well plate at a density of 5×10^4, and 10 μl of CKK8 solution was sequentially added at intervals of 24 h, 48 h, 96 h and 120 h. Continue to cultivate for 4h, and detect the absorbance with a microplate reader at 450nm ( image 3 ). Each group repeated 3-5 holes and took the average value.
[0067] image 3 It shows the proliferation of UCMSCs of HOXA10 virus and UCMSCs transfected with lentiviral vector.
Embodiment 4
[0068] Example 4 Dual-luciferase reporter assay detects that HOXA10 has function in T10-UCMSCs cell line
[0069] Emx2 and ITGB3 promoters were inserted into pGL3-basic vector (Promega), respectively. Lipofectamine 2000 (Invitrogen) facilitated co-transfection of vector and negative control (pGL3-basic) and reporter vector pRL-SV40 plasmids into 293T cells. 48 hours after transfection, the luciferase activity was detected using the Dual Luciferase Reporter Gene Assay Kit (Promega) ( Figure 4 ).
[0070] Conclusion: HOXA10 has function in T10-UCMSCs cell line.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


