Recombinant serratia for expressing dsRNA (double-stranded ribonucleic acid) and application of recombinant serratia
A technology of Serratia and microecological agents, applied in the field of microorganisms and genetic engineering, can solve the problems of loss of recognition and interaction of foreign proteins, loss of resistance, etc., and achieve drug resistance, high targeting, and reduce The effect of hardening
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] The dsRNA recombinant expression plasmid was constructed.
[0032] The synthetic coding gene (GenBank: AF095949), which is published on NCBI (Genbank: AF095949), and gene sequences such as SEQ ID NO.1.
[0033] According to the branch acid disorders gene sequence, the DSRNA encoding gene sequence is designed by codon, and the T7 promoter is added to the upper and downstream, respectively, and the specific sequence such as SEQ ID NO.2.
[0034] The sequence of the above designs, synthesized double-stranded fragments in a whole gene synthesis, seamlessly cloned into KPNI and Hindiii bisase cutting expression plasmid pbbrmcs2, construct recombinant plasmid, bisase testing and sequencing, and confirming recombinant plasmid construction. Success, named PBBR-CM (eg figure 1 Indicated.
[0035] Construction of plasmid pbbr-ALR-T7RP-CM. TAC promoter fusion alanine splite enzyme (from E. coli ATC25922 Alanine splitzyme gene ALR) and a gene fragment of T7 RNA polymerase, two gene fro...
Embodiment 2
[0037] Construction of Thunder Gene Knockout Mutation.
[0038] (1) According to the NCBI database information, the nuclease RNaseiiiii gene (RNC gene) of the Thunderia, the sequence such as SEQ ID NO.4.
[0039] The upstream gene sequence of the RNC gene is fused to 1 knockout fragment, and the whole gene is synthesized, and the specific sequence such as SEQ ID NO.5.
[0040] (2) The knockout fragment is inserted into the EcoRI and Hindiii polyclonal sites of the PK18MobsAcb carrier, and the recombinant plasmid is successfully built, named PK18MOBSACB-RNC (eg image 3 Indicated.
[0041](3) Transform PK18MOBSACB-RNC Transform Escherichia coli S17-1 strain (from South Korea Square Savage Center http: / / kctc.kribb.re.kr / ), with Heriterous Salray (Lai No. KCTC22310, from Korean strains The Warehouse Coutes 48 h at 30 ° C on LB plate, combined with metastasis, S17-1 E. coli, metacoccular hair, plasmid transferred into the tralei, then uses 1 ml of LB liquid culture Base suspension and ...
Embodiment 3
[0053] Construct a recombinant porter of Salrei.
[0054] The constructing recombinant expression plasmid PBBR-ALR-T7RP-CM was transferred to the Hernestharrebiobi double mutant, and PALR-F and PCM-R primers were selected to select a transformant, and a 4200 bp strip appeared. Figure 4 ) The primer sequence is as follows:
[0055] PALR-F: ATGCAAGCGCAACTGTGTGTG;
[0056] PCM-R: tagataagtctgtaaataatttt.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


