Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant serratia for expressing dsRNA (double-stranded ribonucleic acid) and application of recombinant serratia

A technology of Serratia and microecological agents, applied in the field of microorganisms and genetic engineering, can solve the problems of loss of recognition and interaction of foreign proteins, loss of resistance, etc., and achieve drug resistance, high targeting, and reduce The effect of hardening

Pending Publication Date: 2022-02-18
HANGZHOU NORMAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The realization of transgenic plant resistance depends on the interaction between proteins. Foreign proteins trigger a complex disease resistance response signal transduction process through the recognition and interaction with nematode pathogens. Because pathogens exist under unfavorable parasitic conditions Frequent genetic variation, therefore, slight structural variation of pathogenic target proteins will cause foreign proteins to lose recognition and interaction, eventually leading to loss of resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant serratia for expressing dsRNA (double-stranded ribonucleic acid) and application of recombinant serratia
  • Recombinant serratia for expressing dsRNA (double-stranded ribonucleic acid) and application of recombinant serratia
  • Recombinant serratia for expressing dsRNA (double-stranded ribonucleic acid) and application of recombinant serratia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The dsRNA recombinant expression plasmid was constructed.

[0032] The synthetic coding gene (GenBank: AF095949), which is published on NCBI (Genbank: AF095949), and gene sequences such as SEQ ID NO.1.

[0033] According to the branch acid disorders gene sequence, the DSRNA encoding gene sequence is designed by codon, and the T7 promoter is added to the upper and downstream, respectively, and the specific sequence such as SEQ ID NO.2.

[0034] The sequence of the above designs, synthesized double-stranded fragments in a whole gene synthesis, seamlessly cloned into KPNI and Hindiii bisase cutting expression plasmid pbbrmcs2, construct recombinant plasmid, bisase testing and sequencing, and confirming recombinant plasmid construction. Success, named PBBR-CM (eg figure 1 Indicated.

[0035] Construction of plasmid pbbr-ALR-T7RP-CM. TAC promoter fusion alanine splite enzyme (from E. coli ATC25922 Alanine splitzyme gene ALR) and a gene fragment of T7 RNA polymerase, two gene fro...

Embodiment 2

[0037] Construction of Thunder Gene Knockout Mutation.

[0038] (1) According to the NCBI database information, the nuclease RNaseiiiii gene (RNC gene) of the Thunderia, the sequence such as SEQ ID NO.4.

[0039] The upstream gene sequence of the RNC gene is fused to 1 knockout fragment, and the whole gene is synthesized, and the specific sequence such as SEQ ID NO.5.

[0040] (2) The knockout fragment is inserted into the EcoRI and Hindiii polyclonal sites of the PK18MobsAcb carrier, and the recombinant plasmid is successfully built, named PK18MOBSACB-RNC (eg image 3 Indicated.

[0041](3) Transform PK18MOBSACB-RNC Transform Escherichia coli S17-1 strain (from South Korea Square Savage Center http: / / kctc.kribb.re.kr / ), with Heriterous Salray (Lai No. KCTC22310, from Korean strains The Warehouse Coutes 48 h at 30 ° C on LB plate, combined with metastasis, S17-1 E. coli, metacoccular hair, plasmid transferred into the tralei, then uses 1 ml of LB liquid culture Base suspension and ...

Embodiment 3

[0053] Construct a recombinant porter of Salrei.

[0054] The constructing recombinant expression plasmid PBBR-ALR-T7RP-CM was transferred to the Hernestharrebiobi double mutant, and PALR-F and PCM-R primers were selected to select a transformant, and a 4200 bp strip appeared. Figure 4 ) The primer sequence is as follows:

[0055] PALR-F: ATGCAAGCGCAACTGTGTGTG;

[0056] PCM-R: tagataagtctgtaaataatttt.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant serratia for expressing dsRNA (double-stranded ribonucleic acid) and application of the recombinant serratia. The recombinant serratia is obtained by exogenous transfer of a dsRNA coding gene sequence into serratia nematodiphila, and the dsRNA can perform gene silencing on Meloidogyne chorismate mutase. According to the invention, indigenous bacteria are used as carriers, so that the disadvantage that exogenous microorganisms can be hardly colonized in intestinal tracts is overcome. The dsRNA interference object in the invention is a conserved gene, has extremely high targeting property and universality of crossing different species of nematodes, and cannot easily generate drug resistance. Therefore, the recombinant serratia for producing dsRNA is prepared for successfully preventing and treating the plant root knot nematode disease, and the recombinant serratia has important guiding significance and application value for developing novel biopesticides.

Description

Technical field [0001] The present invention relates to the field of microorganisms and genetic engineering, and in particular, to a recombinant salrycine that expresss DSRNA. Background technique [0002] Plant root knots (Meloidogyne) will cause plant nematode disease, plant nematode diseases have increased the harm of agricultural production, resulting in a large number of plants to reduce production. The traditional prevention and treatment of plant root nematodes is difficult to meet the needs of modern agriculture. [0003] The anti-thveragor transgenic breeding of conventional resistance breeding and expression of exogenous protein is mainly limited by the lack of resistance gene and the increasing drug resistance. The realization of transgenic plant resistance relies on the interaction between protein, exogenous protein by identifying and interacting with nematode pathogenesis, triggering complex anti-disease response signaling process, due to pathogens exist under unfavo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/61C12N15/74A01N63/20A01P5/00C12R1/425
CPCC12N9/90C12Y501/01001C12Y504/99005C12N15/74C12N1/20A01N63/20Y02A40/146
Inventor 李海峰
Owner HANGZHOU NORMAL UNIVERSITY