Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of corn ZmRIBA1 gene in breeding of high-lysine corn

A high-lysine, corn breeding technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of lack of balanced nutrition, affecting human health and livestock and poultry production performance, etc. Simple to use effects

Pending Publication Date: 2022-04-12
HENAN AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the total protein of corn contains high gliadin, which lacks essential amino acids such as lysine and tryptophan for humans and animals, which will lead to unbalanced conditions for people, livestock and poultry whose main food is corn. nutrition that affects human health and livestock performance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of corn ZmRIBA1 gene in breeding of high-lysine corn
  • Application of corn ZmRIBA1 gene in breeding of high-lysine corn
  • Application of corn ZmRIBA1 gene in breeding of high-lysine corn

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: corn ZmRIBA1 Affects grain storage material accumulation and lysine content

[0033] The EMS mutagenic mutant ( o18-1 ). o18-1 The background is 3605K (dnj*-N1534, o18-1 ), a single gene recessive mutant generated by EMS mutagenesis by Gerald Neuffer et al. right o18-1 Observation of the grain phenotype of mature mutants revealed that the waxy area of ​​the endosperm decreased and the silty area increased, and the embryo was smaller and deformed (see figure 1 A-C). Germination experiments found that the mutants could not sprout (see figure 1 D). The 100-grain weight of the mutant was significantly lower than that of the wild type (see figure 1 e).

[0034] Using biochemical analysis techniques to analyze the starch and protein content of mature mutant and wild type grains, it was found that the mutant grain starch content was significantly reduced compared with the wild type (see figure 1 F); the total protein content of the mutant has no signif...

Embodiment 2

[0036] Example 2: ZmRIBA1 Gene cloning and functional verification

[0037] Utilize the EMS mutagenesis mutant ( o18-1 ) crossed with W64A corn to get F 1 generation group, F 1 F 2 Generation segregation population, through genetic analysis and map-based cloning, the target gene was located in the physical interval of about 140 kb on the 5th chromosome of maize (see image 3 A).

[0038] The linked markers and their sequences used in the map-based cloning process are shown in Table 1. Gene annotation and sequencing analysis in the candidate segment showed that the gene encoding the first step reaction of riboflavin synthesis Zm00001d016902Gene (CDS sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2) is a potential candidate gene, in the mutant ( o18-1 )middle Zm00001d016902 The gene contains 7 exons, and there is a single-base mutation from G to A at the third exon +1199bp, resulting in the mutation of amino acid 185 from glycine to glutami...

Embodiment 3

[0049] Example 3: Corn ZmRIBA1 Molecular markers

[0050] against o18-1 Develop an easy-to-detect PCR molecular marker dCAPS1 at the mutation site, as follows:

[0051] o18-1 The actual position of the mutation site in the fourth version of the maize B73 reference genome is 179,648,012, and the following dCAPS1 primers were designed:

[0052] dCAPS1-F1: 5' ACAGAGGGCTTCACATCAATTG 3'; (SEQ ID No. 5)

[0053] dCAPS1-R1: 5' CGTTTCAGAACACCCCCTTCT 3'; (SEQ ID No. 6)

[0054] dCAPS1-F2: 5' GAGGCTATGGCTTTTATAGTAAGGCCC 3'; (SEQ ID No. 7)

[0055] dCAPS1-R2: 5' CACTGTAACAGTGAAAGCAGTGC 3'; (SEQ ID No. 8)

[0056] Among them, dCAPS1-F1R1 is the outer primer pair, which can specifically amplify ZmRIBA1 gene sequence (see Figure 4 B). dCAPS1-F2R2 is the inner primer pair, and the PCR product of dCAPS1-F1R1 is used as the template for the second round of amplification.

[0057] against o18-1 Molecular marker detection of mutants, comprising the following steps:

[0058] (1) The r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a corn ZmRIBA1 gene in breeding of high-lysine corn. The corn ZmRIBA1 gene participates in the development of corn kernels, regulates and controls the development of corn embryos and endosperms and the cell cycle of endosperm cells, affects the accumulation of kernel storage substances, plays an important role in increasing the content of lysine in corn, and provides technical support for corn germplasm resource analysis, molecular assisted genetic breeding and the like.

Description

technical field [0001] The invention relates to the technical field of crop molecular breeding, in particular to a corn ZmRIBA1 Gene application in high lysine maize breeding. Background technique [0002] Corn is the world's largest food crop, and it has the unique advantages of food, feed, industrial raw materials and energy crops. With the development of society and the improvement of people's living standards, people's consumption demand for corn is constantly increasing. [0003] However, the total protein of corn contains high gliadin, which lacks essential amino acids such as lysine and tryptophan for humans and animals, which will lead to unbalanced conditions for people, livestock and poultry whose main food is corn. nutrition, affecting human health and livestock performance. [0004] Therefore, cultivating high-quality new corn varieties with high lysine is one of the key research and development directions in the field of plant genetic engineering. Contents ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12Q1/6895
CPCY02A40/146
Inventor 王桂凤田秋珍申清文马雪霞陈洪宇王永彦
Owner HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com