Schizochytrium limacinum genetic engineering strain as well as construction method and application thereof
A technology of genetically engineered strains, Schizochytrium, applied in the field of genetic engineering, can solve problems such as less research on EPA, and achieve the effects of enhancing accumulation, increasing biosynthesis, and weakening synthesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Cloning of Schizochytrium acyl-ACP thioesterase (TE)
[0049] According to the sequence of Schizochytrium acyl-ACP thioesterase (TE):
[0050] ATGGCGACCTTCAACCGGCTTATGAATATCGACGAGGCGAACCCGGCGGGCAACGTGCACGGCGGCCAGCTCTTGCGGTTTATGAGCGACGACGCCGGCTACGTCGCGGCGCTGCGGCACCTCAACAAGGACGCCAAGGGAAAGTTCAATGCGGCGCTGGGCACCGTGTCCAAGACGGCCTTCCACGCGCCAGTCCACGTGGGTGACCTCGTCACCGCGCGGGCCGAGGTCCTTAGCGCTTCGGCGCATAGCCTGGTCGTGCACGTGGACCTCTGGGCCGAAAGCCTCATGACCGGCCACCGCAGACTCACAAACTCCACGGATGCCATCTACGTGGCGCTGGACGCCGATGAAGCGAGGGGGCTCAAGGTGACCTCCGACAAGATCCCACATGTCGAACACGTTGACCACGAAAAGGAGCAGCATGGGCAAGAGGTCTACCGCGAGCATCTTCTTGCGCGTAAAGACGAGACGCAGTCCGCCGCAGAGCTCAAACGCCGCTTCAAGGAGGAGCAGTGGACGGCCTCGCTTGGCCACGTGCTCCTCCCTACGGACTGTGCGCCGACCAACCGCACGGCCAAGGGCGGTCGCATCATCAAGCTAATGGACGAGGTTGGTGCTGTGGCTGCCTGGCGTCACAGCCGCACCAACTGCGTTACGGCCTCCATTGAGACGCTTCGCTTCCGTAAGCCACTTCATCTTGGAGATCTCGTCTCGCTCCGGGCACGTCCCACCTATGCCTCAAGCAAGAGTTTGGAGGTTGAAATCATTGTCGAGACGGCATCGCCCATCACGGGCGAATCTCACATCGCAGCGCACGCCTTTTTCGTCTT...
Embodiment 2
[0055] Example 2 Construction of overexpression vector pBS-Zeo-TE
[0056] This embodiment provides a method for constructing an overexpression vector pBS-Zeo-TE, which method includes the following steps in sequence:
[0057] S1. Enzyme digestion reaction
[0058] The overexpression vector plasmid pBS-Zeo and the PCR purified product Schizochytrium acyl-ACP thioesterase (TE) fragment were double-digested with restriction endonucleases NheI and XbaI respectively in a water bath at 37°C, and digested for 2 hours. 1% agarose gel electrophoresis recovery of digested products;
[0059] 50 μL enzyme digestion system includes: 2 μL NheI, 2 μL XbaI, 5 μL 10X Loading Buffer, 20 μL plasmid, 21 μL ddH 2 O;
[0060] S2. Ligation reaction
[0061] The digested vector pBS-Zeo fragment and the Schizochytrium acyl-ACP thioesterase (TE) fragment were connected by gibson assembly to obtain the recombinant overexpression vector pBS-Zeo-TE;
Embodiment 3
[0068] Example 3 Construction of Schizochytrium Genetic Engineering Strain Overexpressing Acyl-ACP Thioesterase Gene TE
[0069] This embodiment provides a method for constructing a Schizochytrium genetically engineered strain overexpressing the acyl-ACP thioesterase gene TE, the method comprising the following steps in sequence:
[0070] S1. Preparation of Schizochytrium Competent Cells
[0071] S11. Pick a single colony of Schizochytrium sp. HX-308 that has been activated on the plate and put it into 50mL seed culture medium, cultivate it on a shaking table at 28°C and 170r / min for 24h, repeat the cultivation three times, and obtain the bacterial solution beta;
[0072] S12. Take 25 mL of bacterial liquid β, centrifuge at 25°C and 4000 rpm for 2 minutes, discard the supernatant, and obtain bacterial cell γ;
[0073] S13. Use 25mL of pretreatment solution (20mM DTT and 0.1M CaCl 2 Dissolved in Tris-HCl buffer with a pH of 6.5) to resuspend the bacteria, shake slightly to l...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



