Supercharge Your Innovation With Domain-Expert AI Agents!

Schizochytrium limacinum genetic engineering strain as well as construction method and application thereof

A technology of genetically engineered strains, Schizochytrium, applied in the field of genetic engineering, can solve problems such as less research on EPA, and achieve the effects of enhancing accumulation, increasing biosynthesis, and weakening synthesis

Active Publication Date: 2022-05-10
南京脂禾生物科技有限公司
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the content of EPA in Schizochytrium is relatively small, the current research on Schizochytrium mainly focuses on the breeding of excellent strains, the biosynthesis of DHA and the optimization of fermentation conditions. less research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Schizochytrium limacinum genetic engineering strain as well as construction method and application thereof
  • Schizochytrium limacinum genetic engineering strain as well as construction method and application thereof
  • Schizochytrium limacinum genetic engineering strain as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Cloning of Schizochytrium acyl-ACP thioesterase (TE)

[0049] According to the sequence of Schizochytrium acyl-ACP thioesterase (TE):

[0050] ATGGCGACCTTCAACCGGCTTATGAATATCGACGAGGCGAACCCGGCGGGCAACGTGCACGGCGGCCAGCTCTTGCGGTTTATGAGCGACGACGCCGGCTACGTCGCGGCGCTGCGGCACCTCAACAAGGACGCCAAGGGAAAGTTCAATGCGGCGCTGGGCACCGTGTCCAAGACGGCCTTCCACGCGCCAGTCCACGTGGGTGACCTCGTCACCGCGCGGGCCGAGGTCCTTAGCGCTTCGGCGCATAGCCTGGTCGTGCACGTGGACCTCTGGGCCGAAAGCCTCATGACCGGCCACCGCAGACTCACAAACTCCACGGATGCCATCTACGTGGCGCTGGACGCCGATGAAGCGAGGGGGCTCAAGGTGACCTCCGACAAGATCCCACATGTCGAACACGTTGACCACGAAAAGGAGCAGCATGGGCAAGAGGTCTACCGCGAGCATCTTCTTGCGCGTAAAGACGAGACGCAGTCCGCCGCAGAGCTCAAACGCCGCTTCAAGGAGGAGCAGTGGACGGCCTCGCTTGGCCACGTGCTCCTCCCTACGGACTGTGCGCCGACCAACCGCACGGCCAAGGGCGGTCGCATCATCAAGCTAATGGACGAGGTTGGTGCTGTGGCTGCCTGGCGTCACAGCCGCACCAACTGCGTTACGGCCTCCATTGAGACGCTTCGCTTCCGTAAGCCACTTCATCTTGGAGATCTCGTCTCGCTCCGGGCACGTCCCACCTATGCCTCAAGCAAGAGTTTGGAGGTTGAAATCATTGTCGAGACGGCATCGCCCATCACGGGCGAATCTCACATCGCAGCGCACGCCTTTTTCGTCTT...

Embodiment 2

[0055] Example 2 Construction of overexpression vector pBS-Zeo-TE

[0056] This embodiment provides a method for constructing an overexpression vector pBS-Zeo-TE, which method includes the following steps in sequence:

[0057] S1. Enzyme digestion reaction

[0058] The overexpression vector plasmid pBS-Zeo and the PCR purified product Schizochytrium acyl-ACP thioesterase (TE) fragment were double-digested with restriction endonucleases NheI and XbaI respectively in a water bath at 37°C, and digested for 2 hours. 1% agarose gel electrophoresis recovery of digested products;

[0059] 50 μL enzyme digestion system includes: 2 μL NheI, 2 μL XbaI, 5 μL 10X Loading Buffer, 20 μL plasmid, 21 μL ddH 2 O;

[0060] S2. Ligation reaction

[0061] The digested vector pBS-Zeo fragment and the Schizochytrium acyl-ACP thioesterase (TE) fragment were connected by gibson assembly to obtain the recombinant overexpression vector pBS-Zeo-TE;

[0062] 25 μL ligation system includes: 2 μL targ...

Embodiment 3

[0068] Example 3 Construction of Schizochytrium Genetic Engineering Strain Overexpressing Acyl-ACP Thioesterase Gene TE

[0069] This embodiment provides a method for constructing a Schizochytrium genetically engineered strain overexpressing the acyl-ACP thioesterase gene TE, the method comprising the following steps in sequence:

[0070] S1. Preparation of Schizochytrium Competent Cells

[0071] S11. Pick a single colony of Schizochytrium sp. HX-308 that has been activated on the plate and put it into 50mL seed culture medium, cultivate it on a shaking table at 28°C and 170r / min for 24h, repeat the cultivation three times, and obtain the bacterial solution beta;

[0072] S12. Take 25 mL of bacterial liquid β, centrifuge at 25°C and 4000 rpm for 2 minutes, discard the supernatant, and obtain bacterial cell γ;

[0073] S13. Use 25mL of pretreatment solution (20mM DTT and 0.1M CaCl 2 Dissolved in Tris-HCl buffer with a pH of 6.5) to resuspend the bacteria, shake slightly to l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a schizochytrium limacinum genetic engineering strain and a construction method thereof, the schizochytrium limacinum genetic engineering strain takes a Schizochytrium sp.HX-308 strain as a starting strain, and an acyl-ACP thiolipase gene TE in a synthetic route of eicosapentaenoic acid is subjected to multi-copy expression in the starting strain; the invention also discloses an application of the schizochytrium limacinum genetic engineering strain. Eicosapentaenoic acid is produced through fermentation. Through overexpression of the acyl-ACP thiolipase gene TE, the purpose of increasing the yield of eicosapentaenoic acid in the genetic engineering strain is achieved, the method is suitable for construction of the schizochytrium limacinum genetic engineering strain, and the constructed schizochytrium limacinum genetic engineering strain can be used for biosynthesis of eicosapentaenoic acid.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to gene recombination, in particular to a Schizochytrium genetic engineering strain, its construction method and its application. Background technique [0002] Eicosapentaenoic acid (EPA) is an important omega-3 long-chain polyunsaturated fatty acid. EPA can reduce plasma triglyceride, total cholesterol, very low-density lipoprotein and low-density lipoprotein in human blood. At the same time, increase the content of high-density lipoprotein, thereby improving blood circulation, reducing blood viscosity, promoting the excretion of cholesterol, and reducing the content of cholesterol in the blood. At present, the vast majority of EPA comes from deep sea fish oil, and EPA is mainly sold in the form of health products. [0003] Schizochytrium is a heterotrophic and lipid-rich marine organism with great potential for the production of lipid compounds. About 50% of the oil acc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/55C12N15/80C12P7/6432C12P7/6472C12R1/645
CPCC12N9/16C12N15/80C12P7/6427C12P7/6472C12Y301/02014
Inventor 孙小曼马旺向罗平许莹霜汪庆卓
Owner 南京脂禾生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More