Unlock instant, AI-driven research and patent intelligence for your innovation.

Beta-glucan synthase activity detection kit, detection method and application

A glucan synthase and kit technology is applied in the preparation of test samples, measurement devices, color/spectral property measurement, etc., and can solve the problems of increasing radiation hazards for experimenters, insufficient detection sensitivity, and high experimental costs, and achieves The effect of avoiding insecurity, reducing experimental costs, and simplifying experimental operation steps

Pending Publication Date: 2022-05-13
JIANGSU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the detection method of β-glucan synthase activity mainly uses radioactive isotope-labeled UDP-[ 14 C] Glucose as the substrate, UDP-[ 14 C] Changes in the radioactivity of glucose, inferring the degree of polymerization of the transferred glucan chains, thereby determining the activity of β-glucan synthase; however, this method requires an expensive substrate (isotope-labeled UDP-[ 14 C] glucose), professional detection instrument (liquid scintillation counter), and the experiment cost is extremely high; meanwhile, the radioactive substrate UDP-[ 14 C] has a certain degree of danger and increases the radiation hazards to experimenters
Esther Shedletzky et al. established a method for the determination of β-glucan synthase activity. After reacting with UDP-glucose as a substrate, radioactive aniline blue was added as a fluorescent dye to combine with the synthesized β-glucan sugar chains. The activity of β-glucan synthase is calculated by measuring the staining results; this method does not require the radioactive substrate UDP-[ 14 C] Glucose, and there is no need to deal with the synthetic β-glucan product, which simplifies the operation steps of β-glucan synthase activity determination to a certain extent; but the detection sensitivity is insufficient, and the radioactive aniline blue is used as a fluorescent dye The cost is still relatively high, and there are certain insecurities

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-glucan synthase activity detection kit, detection method and application
  • Beta-glucan synthase activity detection kit, detection method and application
  • Beta-glucan synthase activity detection kit, detection method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1: Utilize the recombinant LDENTDP that bacteria Legionella donaldsonii origin detects the activity of frondosa glucan synthase GFGLS

[0044] LDENTDP sequence and its encoding nucleotide sequence:

[0045] Heterologous expression of ENTDP (denoted as LDENTDP) derived from bacteria Legionella donaldsonii: using the exonucleoside triphosphate diphosphate hydrolase ENTDP gene sequence (GenbankAccession: WP_115220965.1) of Legionella donaldsonii as a template, codon optimization in Escherichia coli, after optimization The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. A commercial company is commissioned to synthesize the ldentdp gene sequence, and after adding 6×His tags, the commercial company is commissioned to synthesize it, which is recorded as ldentdp.

[0046] SEQ.ID.NO.1:

[0047] ATGGTTAGCAGCACCGGCCTGAGCAGCGAGACCATTAGCATCACCCTGTGCCTGAACGGCAAAGGTCCGCTGACCTGCCAAAACTACAACGTGGCGAGCCTGAACCTGAGCATCACCACCACC...

Embodiment 2

[0067] Embodiment 2: utilize the recombinant APENTDP of fungus Aspergillus pseudoviridinutans source to detect the activity of Grifola frondosa glucan synthase GFGLS

[0068] ASENTDP sequence and its coding nucleotide sequence:

[0069] The exonucleoside triphosphate diphosphate hydrolase APENTDP gene sequence was retrieved from the genome of the fungus Aspergillus pseudoviridinutans (GenBank: AP024468.1). The CDS sequence and the amino acid sequence encoded by the CDS are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0070] SEQ ID NO.5:

[0071]ATGGGCAAATGGCATTATGGCATCGTCCTAGATGCGGGATCATCTGGGACTCGAGTGCACGTCTATCGGTGGTTGGACCCCGCTATCGCTCGCAAGCACGCAAAAGGTGATGAGCTGAAAACATTACCGGAGATCAAAACTAAGTCGGAATGGACGAAAAAGATACACCCTGGCGTGTCATCGTTCGCCGACAGGCCGGAAGCAGTAGGCCCCGATCATCTTGCGGAACTTCTCAATCATGCTCGCAAGATCATCCCTGCCGATCAGATAAAGGATACTCCCATATTTCTACTGGCCACTGCTGGGATGCGACTCTTACCCAATCGTGATCGCGAGCTTCTATTGCAACAGATCTGCTCCTACGCCAGCGAGAATTATGACTTTTTGCTTCCCGATTGCGGCGTGCACATTCAGGTCATCCCAGGAGTCACAGAGGCCCTCTACG...

Embodiment 3

[0090] Example 3: Utilize the recombinant YLENTDP derived from Yarrowia lipolytica to detect the activity of the β-1,3-glucan synthase VVGLS

[0091] YLENTD sequence and its coding nucleotide sequence:

[0092] The exonucleoside triphosphate diphosphate hydrolase PHENTDP sequence (Accession: CP061017.1) was retrieved from the Yarrowia lipolytica CLIB122 genome (GenBank: ASM252v1), and its coding nucleotide sequence and amino acid sequence are shown in SEQ ID NO. 9 and shown in SEQ ID NO.10.

[0093] SEQ ID NO.9:

[0094] CTAGTATCCAGCGGCATTCTGGAGGGCGACACCGAGTGCCCAGGAGACCTCGTTTCCTCCGTGGCTCTTTACCGTCTTCAGTGGTCTGTCTAAGGCAATACCATAGCCTGAGTGAAGAAGAGTGTACATGAACGACAGATCGAGACACCATTCTGGACGTCCCTGAAGCTCTTTGAAAGCCATTTCAGAAAGTCCAGAGATATCTGTCCATTGCCCATGGCACACCTTCTCCTGAAGCCTTTTCACATCTCTTAGAGAGAACTCGTTCTGGAGGCCCAGGTTTGAGGTACGATCATAGAAATACGAAATCAAATACAAGTCTCCATTGTAGGTGCCGATGGGAGGCTGGTAGACATTGTTGATTGAGCAGGACGAATGGGTGCAAGGCTCGGTGTGGAGAATCTTCTCCATGTAAGCGATACACTCCTGGTCGTTCAAAACGTCAGAAGTCAGTTCGTAGCCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a beta-glucan synthetase activity detection kit, a detection method and application, and belongs to the technical field of enzymes. In the invention, the kit for determining the activity of the beta-glucan synthetase mainly comprises exonucleoside triphosphate diphosphate hydrolase (ENTDP) capable of hydrolyzing uridine diphosphate (UDP) to release phosphate radicals and a reagent for determining the content of the released phosphate radicals, the kit for determining the activity of the beta-glucan synthetase can be used for rapidly and accurately determining the content of a by-product uridine diphosphate (UDP) formed in the process of synthesizing a beta-glucan sugar chain by the beta-glucan synthetase by taking UDP-glucose as a substrate, so that the activity of the beta-glucan synthetase is accurately calculated; the kit and the method for determining the activity of the beta-glucan synthetase have the obvious advantages of low equipment requirement, safety, simplicity and convenience in operation, high sensitivity, low cost and the like.

Description

technical field [0001] The invention belongs to the technical field of enzymes, and in particular relates to a detection kit, detection method and application of β-glucan synthase activity. Background technique [0002] Glucan (Glucan) is a large class of macromolecular polymers formed by α / β-1,3, 1,4 or 1,6-glucosidic bonds linking glucose monomers, which are important structures of plant and fungal cell walls One of the components, it plays a key role in maintaining cell shape and integrity, protecting cells from internal expansion pressure and other external environmental influences. In recent years, studies have shown that β-1,3, 1,4 or 1,6-glucan derived from fungi has significant functions such as enhancing immunity, regulating intestinal flora, and lowering blood sugar, and has now become a fungal product for food and medicine. One of the main index components. The immunomodulatory activity of glucans varies widely due to their chemical composition, configuration, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N1/28G01N21/31G01N30/96
CPCG01N1/28G01N21/3103G01N30/96
Inventor 崔凤杰付鑫昝新艺梁英英
Owner JIANGSU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More