Beta-glucan synthase activity detection kit, detection method and application
A glucan synthase and kit technology is applied in the preparation of test samples, measurement devices, color/spectral property measurement, etc., and can solve the problems of increasing radiation hazards for experimenters, insufficient detection sensitivity, and high experimental costs, and achieves The effect of avoiding insecurity, reducing experimental costs, and simplifying experimental operation steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment 1: Utilize the recombinant LDENTDP that bacteria Legionella donaldsonii origin detects the activity of frondosa glucan synthase GFGLS
[0044] LDENTDP sequence and its encoding nucleotide sequence:
[0045] Heterologous expression of ENTDP (denoted as LDENTDP) derived from bacteria Legionella donaldsonii: using the exonucleoside triphosphate diphosphate hydrolase ENTDP gene sequence (GenbankAccession: WP_115220965.1) of Legionella donaldsonii as a template, codon optimization in Escherichia coli, after optimization The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. A commercial company is commissioned to synthesize the ldentdp gene sequence, and after adding 6×His tags, the commercial company is commissioned to synthesize it, which is recorded as ldentdp.
[0046] SEQ.ID.NO.1:
[0047] ATGGTTAGCAGCACCGGCCTGAGCAGCGAGACCATTAGCATCACCCTGTGCCTGAACGGCAAAGGTCCGCTGACCTGCCAAAACTACAACGTGGCGAGCCTGAACCTGAGCATCACCACCACC...
Embodiment 2
[0067] Embodiment 2: utilize the recombinant APENTDP of fungus Aspergillus pseudoviridinutans source to detect the activity of Grifola frondosa glucan synthase GFGLS
[0068] ASENTDP sequence and its coding nucleotide sequence:
[0069] The exonucleoside triphosphate diphosphate hydrolase APENTDP gene sequence was retrieved from the genome of the fungus Aspergillus pseudoviridinutans (GenBank: AP024468.1). The CDS sequence and the amino acid sequence encoded by the CDS are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0070] SEQ ID NO.5:
[0071]ATGGGCAAATGGCATTATGGCATCGTCCTAGATGCGGGATCATCTGGGACTCGAGTGCACGTCTATCGGTGGTTGGACCCCGCTATCGCTCGCAAGCACGCAAAAGGTGATGAGCTGAAAACATTACCGGAGATCAAAACTAAGTCGGAATGGACGAAAAAGATACACCCTGGCGTGTCATCGTTCGCCGACAGGCCGGAAGCAGTAGGCCCCGATCATCTTGCGGAACTTCTCAATCATGCTCGCAAGATCATCCCTGCCGATCAGATAAAGGATACTCCCATATTTCTACTGGCCACTGCTGGGATGCGACTCTTACCCAATCGTGATCGCGAGCTTCTATTGCAACAGATCTGCTCCTACGCCAGCGAGAATTATGACTTTTTGCTTCCCGATTGCGGCGTGCACATTCAGGTCATCCCAGGAGTCACAGAGGCCCTCTACG...
Embodiment 3
[0090] Example 3: Utilize the recombinant YLENTDP derived from Yarrowia lipolytica to detect the activity of the β-1,3-glucan synthase VVGLS
[0091] YLENTD sequence and its coding nucleotide sequence:
[0092] The exonucleoside triphosphate diphosphate hydrolase PHENTDP sequence (Accession: CP061017.1) was retrieved from the Yarrowia lipolytica CLIB122 genome (GenBank: ASM252v1), and its coding nucleotide sequence and amino acid sequence are shown in SEQ ID NO. 9 and shown in SEQ ID NO.10.
[0093] SEQ ID NO.9:
[0094] CTAGTATCCAGCGGCATTCTGGAGGGCGACACCGAGTGCCCAGGAGACCTCGTTTCCTCCGTGGCTCTTTACCGTCTTCAGTGGTCTGTCTAAGGCAATACCATAGCCTGAGTGAAGAAGAGTGTACATGAACGACAGATCGAGACACCATTCTGGACGTCCCTGAAGCTCTTTGAAAGCCATTTCAGAAAGTCCAGAGATATCTGTCCATTGCCCATGGCACACCTTCTCCTGAAGCCTTTTCACATCTCTTAGAGAGAACTCGTTCTGGAGGCCCAGGTTTGAGGTACGATCATAGAAATACGAAATCAAATACAAGTCTCCATTGTAGGTGCCGATGGGAGGCTGGTAGACATTGTTGATTGAGCAGGACGAATGGGTGCAAGGCTCGGTGTGGAGAATCTTCTCCATGTAAGCGATACACTCCTGGTCGTTCAAAACGTCAGAAGTCAGTTCGTAGCCT...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



