Corynebacterium glutamicum engineering strain for preparing psicose and its application
A technology of Corynebacterium glutamicum and allulose, which is applied to engineering strains of Corynebacterium glutamicum and its application in the preparation of allulose, can solve adverse food safety, food and environmental safety threats, difficult Improve the level of enzyme expression and other issues to achieve the effect of low acetic acid accumulation and easy scale-up culture
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1, the acquisition of low acetic acid synthetic Corynebacterium glutamicum strain
[0034] Acetic acid concentration in the fermentation medium severely affects protein expression, so obtaining a strain with low acetate synthesis is crucial for protein expression. The acetic acid synthesis of Corynebacterium glutamicum strain 13032 and the patented Corynebacterium glutamicum M19 (CN202110967055.X), which are currently widely used, were tested respectively. The specific operations are as follows:
[0035] 1. Cultivation of Corynebacterium glutamicum seed solution
[0036] 100 mL of BHI medium (brain heart infusion powder 37 g / L) was used to culture Corynebacterium glutamicum M19 and 13032 for 24 h at 30 °C and 200 rmp.
[0037] 2. Preparation of fermentation medium CGXII, its formula is: (NH 4 ) 2 SO 4 (5g / L), urea (5g / L), KH 2 PO 4 (1g / L), K 2 HPO 4 (1g / L), MgSO 4 ∙7H 2 O (0.25g / L), CaCl 2 (10mg / L), FeSO 4 ∙7H 2 O (10mg / L), MnSO 4 ∙H 2 O (0...
Embodiment 2
[0039] Example 2. Construction of alanine-deficient Corynebacterium glutamicum recombinant strains
[0040] By knocking out the alanine racemase gene in Corynebacterium glutamicum M19, a D-alanine-deficient Corynebacterium glutamicum recombinant strain is constructed, and the construction process includes the following steps:
[0041] 1. Construction of alanine racemase gene ( alr ) knockout vector pK18alr
[0042] 1.1 According to Genbank Corynebacterium glutamicum lar The upstream region of the gene (Genbank No: 1018592) alr-up (863bp) and alr gene downstream region alr-down (953bp) nucleotide sequence to design gene knockout primers, the primer sequences are as follows:
[0043] Delalr-1: GACCGGAATTCTAGCTTCAGCGTCTGGTTCGGAGA
[0044] Delalr-2: CTGCTCCTTAAACGTATTCACTTAATCCAGGTCAATTTTGGTGGTCA
[0045] Delalr-3: TGACCACCAAAATTGACCTGGATTAAGTGAATACGTTTAAGGAGCAG
[0046] Delalr-4: GACTCAAGCTTGGATGACGATGTCGGTATTTGCA
[0047] 1.2 Using the genomic DNA of Corynebacterium g...
Embodiment 3
[0056] Example 3. Construction of recombinant plasmids carrying alanine racemase and DPE genes
[0057] 1. Construction of recombinant plasmid carrying alanine racemase
[0058] Primers were designed according to the alanine racemase gene alr sequence in the genome of Corynebacterium glutamicum in the database to amplify the sequence "Promoter-alr-Terminator" containing the promoter, alanine racemase and terminator, and connect by enzyme cutting The method was constructed into the recombinant expression vector pEC-XK99E to obtain the recombinant expression vector pEC-alr. The primer sequences used were:
[0059] ECalr-1:GATCCCCCGGGCCTTTGTGGTCTGGCATGAAG,
[0060] EC-alr-2: AACGCGGATCCCAAAATCACCACATCGCCAGC.
[0061] 2. Construct a recombinant plasmid carrying both alanine racemase and DPE gene
[0062] PCR amplification of the RDPE gene (the encoded amino acid sequence is shown in SEQ ID NO. 1), amplification of the tuf promoter derived from Corynebacterium glutamicum (the n...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


