Unlock instant, AI-driven research and patent intelligence for your innovation.

Corynebacterium glutamicum engineering strain for preparing psicose and its application

A technology of Corynebacterium glutamicum and allulose, which is applied to engineering strains of Corynebacterium glutamicum and its application in the preparation of allulose, can solve adverse food safety, food and environmental safety threats, difficult Improve the level of enzyme expression and other issues to achieve the effect of low acetic acid accumulation and easy scale-up culture

Active Publication Date: 2022-08-09
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Microorganisms are used to express DPE enzymes, usually in the form of plasmid expression. In order to maintain the stability of the plasmid, antibiotics need to be added to the fermentation broth, which is not conducive to food safety; for example, in the patent CN104160023B, 10 micrograms / ml is needed to cultivate Corynebacterium glutamicum expressing DPE. Kanamycin poses a certain threat to food and environmental safety
Expressing DPE enzyme in the form of chromosomal integration is limited by the copy number, and it is difficult to increase the expression level of the enzyme. Therefore, how to achieve safe and high-level expression of DPE enzyme in the host strain is an urgent problem to be solved.
In addition, most DPE enzymes are neutral alkaline enzymes, and Corynebacterium glutamicum will accumulate a large amount of acetic acid during high-density fermentation, which will have a certain adverse effect on the enzyme activity of DPE enzymes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corynebacterium glutamicum engineering strain for preparing psicose and its application
  • Corynebacterium glutamicum engineering strain for preparing psicose and its application
  • Corynebacterium glutamicum engineering strain for preparing psicose and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, the acquisition of low acetic acid synthetic Corynebacterium glutamicum strain

[0034] Acetic acid concentration in the fermentation medium severely affects protein expression, so obtaining a strain with low acetate synthesis is crucial for protein expression. The acetic acid synthesis of Corynebacterium glutamicum strain 13032 and the patented Corynebacterium glutamicum M19 (CN202110967055.X), which are currently widely used, were tested respectively. The specific operations are as follows:

[0035] 1. Cultivation of Corynebacterium glutamicum seed solution

[0036] 100 mL of BHI medium (brain heart infusion powder 37 g / L) was used to culture Corynebacterium glutamicum M19 and 13032 for 24 h at 30 °C and 200 rmp.

[0037] 2. Preparation of fermentation medium CGXII, its formula is: (NH 4 ) 2 SO 4 (5g / L), urea (5g / L), KH 2 PO 4 (1g / L), K 2 HPO 4 (1g / L), MgSO 4 ∙7H 2 O (0.25g / L), CaCl 2 (10mg / L), FeSO 4 ∙7H 2 O (10mg / L), MnSO 4 ∙H 2 O (0...

Embodiment 2

[0039] Example 2. Construction of alanine-deficient Corynebacterium glutamicum recombinant strains

[0040] By knocking out the alanine racemase gene in Corynebacterium glutamicum M19, a D-alanine-deficient Corynebacterium glutamicum recombinant strain is constructed, and the construction process includes the following steps:

[0041] 1. Construction of alanine racemase gene ( alr ) knockout vector pK18alr

[0042] 1.1 According to Genbank Corynebacterium glutamicum lar The upstream region of the gene (Genbank No: 1018592) alr-up (863bp) and alr gene downstream region alr-down (953bp) nucleotide sequence to design gene knockout primers, the primer sequences are as follows:

[0043] Delalr-1: GACCGGAATTCTAGCTTCAGCGTCTGGTTCGGAGA

[0044] Delalr-2: CTGCTCCTTAAACGTATTCACTTAATCCAGGTCAATTTTGGTGGTCA

[0045] Delalr-3: TGACCACCAAAATTGACCTGGATTAAGTGAATACGTTTAAGGAGCAG

[0046] Delalr-4: GACTCAAGCTTGGATGACGATGTCGGTATTTGCA

[0047] 1.2 Using the genomic DNA of Corynebacterium g...

Embodiment 3

[0056] Example 3. Construction of recombinant plasmids carrying alanine racemase and DPE genes

[0057] 1. Construction of recombinant plasmid carrying alanine racemase

[0058] Primers were designed according to the alanine racemase gene alr sequence in the genome of Corynebacterium glutamicum in the database to amplify the sequence "Promoter-alr-Terminator" containing the promoter, alanine racemase and terminator, and connect by enzyme cutting The method was constructed into the recombinant expression vector pEC-XK99E to obtain the recombinant expression vector pEC-alr. The primer sequences used were:

[0059] ECalr-1:GATCCCCCGGGCCTTTGTGGTCTGGCATGAAG,

[0060] EC-alr-2: AACGCGGATCCCAAAATCACCACATCGCCAGC.

[0061] 2. Construct a recombinant plasmid carrying both alanine racemase and DPE gene

[0062] PCR amplification of the RDPE gene (the encoded amino acid sequence is shown in SEQ ID NO. 1), amplification of the tuf promoter derived from Corynebacterium glutamicum (the n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of industrial biotechnology, in particular to a Corynebacterium glutamicum engineering strain for preparing psicose and its application in the preparation of psicose. In the present invention, D-psicose 3-epimerase is introduced into host cells through an expression vector in a strain with low acetic acid production to achieve high-efficiency expression. The recombinant strain has low acetic acid accumulation and is relatively easy to scale up and cultivate. It is very suitable for large-scale preparation of DPE protein and is used in the psicose biological preparation system. At the same time, the strain avoids adding antibiotics during the culture process and is safer.

Description

technical field [0001] The invention relates to the field of industrial biotechnology, in particular to a Corynebacterium glutamicum engineering strain for preparing psicose and its application in the preparation of psicose. Background technique [0002] D-psicose is an epimer of fructose, its sweetness is 70% of that of sucrose, but its energy value is only 0.4kcal / g, and its energy absorption efficiency is only 0.3% of that of sucrose. D-psicose is a low-calorie sweetener that can be used in the food field as a sucrose substitute; D-psicose has been shown to have hypoglycemic effects and can also inhibit the activity of hepatic liposynthase intestinal alpha-glucosidase, thereby reducing abdominal Fat accumulation also has high medical value in the treatment of neurodegenerative and atherosclerotic diseases. The U.S. Food and Drug Administration (FDA) officially approved D-psicose as a GRAS food in 2011, allowing it to be used in food, pharmaceutical preparations and dieta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/77C12N9/90C12N1/21C12P19/24C12P19/02C12R1/15
CPCC12N15/77C12N9/90C12P19/24C12P19/02C12Y501/03
Inventor 杨建刚朱玥明陈朋孙媛霞
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI