Method for increasing yield of antifungal active substance HSAF and application

An active substance, antifungal technology, applied in the field of increasing the production of antifungal active substance HSAF, can solve the problems of bacterial cell death, unsustainable synthesis of HSAF, and complexity.

Pending Publication Date: 2022-07-15
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

One of the factors causing its low yield is that the strain will autolyse soon after entering the stable growth phase during the fermentation process, and a large number of bacteria will die, resulting in the inability to continuously synthesize HSAF
Due to the large and complex chemical structure of the HSAF synthetic gene cluster, it is difficult to obtain by biosynthesis or chemical synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing yield of antifungal active substance HSAF and application
  • Method for increasing yield of antifungal active substance HSAF and application
  • Method for increasing yield of antifungal active substance HSAF and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] The construction of embodiment 1 engineering strain

[0017] The specific program for the knockout of Hfq gene is as follows:

[0018] Gene Knockout Strategy Reference figure 1 .

[0019] Use primers Hfq-F1 / R1 and Hfq-F2 / R2 to amplify the upstream and downstream fragments Hfq-s and Hfq-x of the hfq gene, respectively. The primer sequences are as follows:

[0020] Hfq-F1: CGGAATTCGAACTGGAGCACGCCCTGAG (the underline indicates the EcoRI restriction site)

[0021] Hfq-R1: GCTCTAGAGCAGCTTGATGCCGTTGACC (underlined indicates XbaI restriction site)

[0022] Hfq-F2: GCTCTAGAGGCAGCGACGAGAACGAATAAG (underlined indicates XbaI restriction site)

[0023] Hfq-R2: CCCAAGCTTAACGGGTGGTTGACCAGGATC (underlined indicates HindIII restriction site)

[0024] The Hfq-s fragment was treated with restriction endonucleases EcoRI and XbaI, and the fragment under Hfq-x was treated with XbaI and HindIII, then the above fragment was ligated to the suicide vector pEX18Gm treated with EcoRI and Hin...

Embodiment 2

[0032] Example 2 Growth curve determination

[0033]A single colony of the wild-type OH11 and the engineered strain MHfq were picked and cultured overnight in LB liquid medium at 28°C with shaking. The bacterial solution was inoculated into a new 10% TSB liquid medium at a ratio of 1%, and the culture was continued at 28°C with shaking. Every 2 hours, take out 500 μL of bacterial solution, measure and record the OD600nm value with a spectrophotometer, and finally form a complete growth curve, such as image 3 shown. It can be seen from the figure that the OD value of the wild-type OH11 decreased from about 16 hours, while the engineering strain Mhfq showed obvious autolysis at 24 hours. Therefore, the engineered strain prolongs the fermentation time by about 8 hours by delaying the autolysis time.

Embodiment 3

[0034] Example 3 HSAF yield assay

[0035] A single colony of the wild-type OH11 and the engineered strain MHfq were picked and cultured overnight in LB liquid medium at 28°C with shaking. The bacterial solution was inoculated into a new 10% TSB liquid medium at a ratio of 1%, and the culture was continued at 28°C for 24 hours with shaking. Take 4 mL of bacterial liquid, add 16 μL of concentrated hydrochloric acid to adjust the acid, and then use 4 mL of ethyl acetate to extract the metabolites of Lysobacter enzyme-producing bacteria, and then evaporate the ethyl acetate to dryness to obtain the bold substance of HSAF. After the crude substance was dissolved in 200 μL of methanol, the HSAF production could be detected by a high performance liquid chromatography (HPLC) system. The result is as Figure 4 shown, the HSAF production of the mutant Mhfq was significantly higher than that of the wild-type OH11, with an approximately 66% increase in production.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for increasing the yield of an antifungal active substance HSAF and application. According to the invention, an RNA chaperone molecular protein Hfq on a lysobacter enzymogenes OH11 strain genome is knocked out by using a homologous recombination method, so that a strain delta Hfq is obtained. The strain delays the autolysis phenomenon, so that the effective fermentation time is prolonged, the yield of the active metabolite HSAF of the strain is increased, and a foundation is laid for industrial development of the HSAF.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, and in particular relates to a method and application for improving the yield of an antifungal active substance HSAF. Background technique [0002] Lysobacter (Lysobacter) belongs to the Xanthomonas family, γ-Proteobacteria, and widely exists in various natural environments. The bacteria of this genus can not only secrete a variety of extracellular hydrolases (α-proteolytic enzyme, β-1,3-glucanase, chitinase, etc.), but also synthesize secondary metabolic antibacterial substances, which are to be developed. A rich library of natural active substances. [0003] HSAF is a substance with broad-spectrum antagonistic activity against pathogenic fungi and oomycetes produced by Lysobacter enzymogenes OH11. The substance has high activity, 0.5μg / mL can significantly inhibit pear rot bacteria, and has very good heat resistance, so it is named heat stable antifungal factor HSAF (Heat Stable A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/74C12N15/90C12N15/31C12P17/18C12N1/21A01N63/20A01P3/00C05F11/08C05F17/20C05G3/60C12R1/01
CPCC07K14/195C12N15/74C12N15/902C12P17/182A01N63/20C05F11/08C05F17/20C05G3/60
Inventor徐高歌赵延存刘凤权
OwnerJIANGSU ACADEMY OF AGRICULTURAL SCIENCES