Technique for constructing high-virulent nuclear polyhedrosis virus of lepidoptera pest
A nuclear polyhedrosis, lepidopteran technology, applied in the direction of virus/phage, recombinant DNA technology, introduction of foreign genetic material using vectors, etc., can solve the problems of slow insecticidal speed, unsatisfactory control effect, long incubation period, etc. Control effect, fast spread and reinfection speed, high virulence effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] Example NPV construction method containing tea geometrid chitin synthase (CS) double-strand interference gene sequence:
[0021] 1) Take about 100 mg of 1 third-instar tea geometrid larvae, extract total RNA with Trizol (Invitrogen Company) reagent, detect RNA quality by electrophoresis, and analyze RNA concentration with GENQUENT. For specific operations, refer to the reagent and instrument instructions.
[0022] 2) Synthesize the first strand of cDNA of tea geometrid larvae with the MMLV first strand cDNA synthesis kit (Shanghai Sangong), and refer to the kit instructions for specific operations.
[0023] 3) Perform RT-PCR with specific primers for L-CSO / R-CSO (synthesized by Shanghai Sangon). PCR conditions are shown in Table 1.
[0024] L-CS0 5’TTCGAATACGCCATCGGCCATTGG
[0025] R-CS0 5'CCAACGATCCTCGCCCTGATCGTACTG
[0026] PCR reaction system
PCR reaction conditions
The 25μl reaction solution contains:
10×PCR amplification buffer: 2.5 μl,...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap