Unlock instant, AI-driven research and patent intelligence for your innovation.

Technique for constructing high-virulent nuclear polyhedrosis virus of lepidoptera pest

A nuclear polyhedrosis, lepidopteran technology, applied in the direction of virus/phage, recombinant DNA technology, introduction of foreign genetic material using vectors, etc., can solve the problems of slow insecticidal speed, unsatisfactory control effect, long incubation period, etc. Control effect, fast spread and reinfection speed, high virulence effect

Inactive Publication Date: 2006-07-19
ZHEJIANG UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the wild-type NPV virus strain has low infection rate, long incubation period, slow insecticidal speed, and unsatisfactory control effect.
Therefore, the popularization and application of NPV biopesticides in actual production is still relatively limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Technique for constructing high-virulent nuclear polyhedrosis virus of lepidoptera pest

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] Example NPV construction method containing tea geometrid chitin synthase (CS) double-strand interference gene sequence:

[0021] 1) Take about 100 mg of 1 third-instar tea geometrid larvae, extract total RNA with Trizol (Invitrogen Company) reagent, detect RNA quality by electrophoresis, and analyze RNA concentration with GENQUENT. For specific operations, refer to the reagent and instrument instructions.

[0022] 2) Synthesize the first strand of cDNA of tea geometrid larvae with the MMLV first strand cDNA synthesis kit (Shanghai Sangong), and refer to the kit instructions for specific operations.

[0023] 3) Perform RT-PCR with specific primers for L-CSO / R-CSO (synthesized by Shanghai Sangon). PCR conditions are shown in Table 1.

[0024] L-CS0 5’TTCGAATACGCCATCGGCCATTGG

[0025] R-CS0 5'CCAACGATCCTCGCCCTGATCGTACTG

[0026] PCR reaction system

PCR reaction conditions

The 25μl reaction solution contains:

10×PCR amplification buffer: 2.5 μl,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The technique to modify NPV and construct high-virulence NPV of Lepidoptera pest with modern dsRNA interference molecular biological technique comprises: (1) cloning CS conservative sequence of geometrid; (2) constructing the dsRNA intermediate carrier for the lepidopterid CS gene; (3) constructing the NPV transfer carrier contained CS dsRNA interference sequence; (4) recombining NPV, validating the NPV with PCR or other methods; finally, contrast with wild NPV, evaluating the insect disinfectation capacity of recombined NPV to screen the virus strain with higher virulence and faster diffusion and secondary infection speed and better prevention effect.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a technique for transforming wild nuclear polyhedrosis virus (NPV) and constructing highly virulent NPV of lepidopteran pests by means of double-stranded RNA interference and other modern molecular biology methods. Background technique [0002] Lepidoptera insects, such as inchworms and caterpillars, are one of the important pest species that damage crops. When these pests occur in large numbers, they cause severe crop yield and quality deterioration. Therefore, Lepidoptera insects such as inchworms are one of the important control objects in crop production. At present, there are two main types of pesticides used in production: one is chemically synthesized pesticides, such as pyrethroid pesticides, organophosphorus pesticides and diflubenzuron, etc.; the other is biological pesticides, such as nuclear polyhedrosis virus (NPV) preparations , Bacillus thuringiensis (Bt) preparations ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/63
Inventor 陆建良梁月荣张广辉林晨杜颖颖潘顺顺
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More