CDK2 antagonists as short form C-MAF transcription factor antagonists for treatment of glaucoma

A transcription factor, technology for glaucoma

Inactive Publication Date: 2006-12-27
ALCON INC
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Such adverse side effects can lead to decreased patient compliance or discontinuation of treatment
[0006] More importantly, current anti-glaucoma treatments do not directly address pathological damage to the loss of persistently unattenuated trabecular meshwork, optic nerve, and retinal ganglion cells and axons

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CDK2 antagonists as short form C-MAF transcription factor antagonists for treatment of glaucoma
  • CDK2 antagonists as short form C-MAF transcription factor antagonists for treatment of glaucoma
  • CDK2 antagonists as short form C-MAF transcription factor antagonists for treatment of glaucoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Isolation of RNA from Human Trabecular Mesh Tissue and Cells

[0034] Human trabecular meshwork (TM) cells were obtained from donor eyes (Central Florida Lions Eye and Tissue Bank, Tampa, FL) and cultured as previously described (Steely, et al. (1992), Invest Ophthalmol Vis Sci 33(7):2242-50 ; Wilson et al. (1993), Curr Eye Res 12(9): 783-93; Clark, et al. (1994), Invest Ophthalmol Vis Sci 35(1): 281-94.; Dickerson, et al. (1998), Exp Eye Res 66(6):731-8; Wang, et al. (2001), MolVis 7:89-94). TM cells were derived from pools of four normal or glaucomatous cell lines. According to the manufacturer's instructions (Invitrogen, Carlsbad, CA), with TRIZOL  Reagents to isolate total RNA from TM cells of each pool.

Embodiment 2

[0036] Affymetrix microarray analysis

[0037] Reverse transcription, second-strand cDNA synthesis, and biotin labeling of amplified RNA were performed according to standard Affymetrix protocols. Human genome U133A and U133B GENECHIPS according to the standard Affymetrix protocol  (Affymetrix, Santa Clara, CA) for hybridization, washing and scanning. use GENEARRAY  A scanner (Agilent Technologies, Palo Alto, CA) scanned the hybridized GENECHIP  array. Raw data were collected and analyzed with Affymetrix Microarray Suite software.

[0038] Filtering of microarray data was performed using GENESPRINCP(R) software (Silicon Genetics, Redwood City, CA). For each experiment, the data for each chip were normalized by dividing each measurement by 50 percent of all signal intensity measurements for that chip. For each experiment, the expression rate for each gene was calculated by dividing the normalized signal for each gene in the treated or diseased samples ...

Embodiment 3

[0040] Quantitative PCR

[0041] First-strand cDNA was generated from 1 μg of total RNA using random hexamers and TAQMAN(R) reverse transcription reagent according to the manufacturer's instructions (Applied Biosystems, Foster City, CA). 100 μl of the reaction was then diluted 20-fold to achieve an effective cDNA concentration of 0.5 ng / μl.

[0042] ABI PRISM was used essentially as described by Shepard, et al. (2001) Invest Ophthalmol Vis Sci 42(13):3173-81  Measurement of short form c-Maf gene expression was performed by quantitative real-time RT-PCR (QPCR) with the 7700 Sequence Detection System (Applied Biosystems). Use PRIMER EXPRESS  The software (Applied Biosystems) designed primers for short form specific c-Maf amplification (Genbank accession number AF055376). The forward and reverse primer sequences are TTGGGACTGAATTGCACTAAGATATAA, SEQ ID NO: 1, (nucleotides 3773-3799) and GCGTTCTAAACAGTTTTGCAATTTT, SEQ ID NO: 2, (nucleotides 3823-3847...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The short form version of c-Maf transcription factor is up-regulated in steroid-treated and transforming growth factor beta2-treated trabecular meshwork cells, and is present at elevated levels in glaucomatous versus normal trabecular meshwork cells and in glaucomatous versus normal optic nerve head tissue. Expression of short form c-Maf transcription factor under these conditions indicates a causal or effector role for the factor in primary open-angle and steroid-induced glaucoma pathogenesis. Antagonism of short form c-Maf transcription factor expression and / or activity in the trabecular meshwork or other ocular tissue is provided for inhibiting or alleviating glaucoma pathogenesis. Antagonists include cyclin-dependent kinase 2 inhibitors.

Description

field of invention [0001] The present invention relates to the field of preventive and therapeutic agents for glaucoma, especially primary open-angle glaucoma and steroid-induced glaucoma. Background of the invention [0002] The Trabecular Mesh (TM) is a complex tissue comprising endothelial cells, connective tissue and extracellular matrix located at the angle between the cornea and iris that provides the normal resistance needed to maintain intraocular pressure (IOP). Adequate intraocular pressure is required to maintain the shape of the eye and to provide a pressure gradient for the flow of aqueous humor to the avascular cornea and lens. Excessive IOPs commonly present in glaucoma have deleterious effects on the optic nerve, leading to loss of retinal ganglion cells and axons and, if left untreated, progressive vision loss and blindness. Glaucoma is one of the leading causes of blindness worldwide. [0003] Primary glaucoma, which results from disturbances in the flow ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K31/52A61P27/06A61K31/00
CPCA61K31/52A61K31/00A61P27/06A61P43/00A61K31/519
InventorA·R·谢帕德N·雅各布森A·F·克拉克
OwnerALCON INC