Unlock instant, AI-driven research and patent intelligence for your innovation.

Anktm1, a cold-activated trp-like channel expressed in nociceptive neurons

a nociceptive neuron, cold-activated technology, applied in the direction of peptides, drug compositions, tissue culture, etc., can solve the problems of limiting the utility of opiates for controlling post-injury pain, central neurons in the spinal cord to develop an exaggerated response to subsequent, additional discomfort, etc., to reduce nociceptive pain and reduce nociceptive pain.

Inactive Publication Date: 2006-06-29
NOVARTIS AG +1
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0019] In yet another embodiment, the invention provides methods for modulating nociceptive pain in a sentient organism that contains a polypeptide sequence comprising an amino acid sequence selected from SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:4, and conservative variations thereof by contacting the organism with an effective amount of an agent that modulates operation of the polypeptide under conditions that allow the agent and the polypeptide to interact, thereby modulating nociceptive pain in the organism.
[0020] In still another embodiment, the invention provides methods for reducing nociceptive pain in an organism by contacting an organism containing an invention isolated nucleic acid sequence with an effective amount of an agent that blocks function of the polynucleotide sequence under conditions that allow the agent and the polynucleotide to interact, thereby reducing nociceptive pain in the organism.

Problems solved by technology

Activity is initiated by the application of a high intensity, potentially damaging stimulus.
Secondly, spontaneous activity in small sensory afferent causes central neurons in the spinal cord to develop an exaggerated response to subsequent input.
However, many of these agents are addictive or have side effects that often provide additional discomforts to a subject when taken over a long period of time.
These effects serve to limit the utility of opiates for controlling post injury pain.
Addiction liability can occur secondary to medical uses of the drug where the central effects lead to an addicted and dependent state.
Pain is a major problem for the individual sufferer and for society because of the high costs involved in managing pain.
Terminally ill subjects often suffer immensely because our ability to effectively manage pain is inadequate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anktm1, a cold-activated trp-like channel expressed in nociceptive neurons
  • Anktm1, a cold-activated trp-like channel expressed in nociceptive neurons
  • Anktm1, a cold-activated trp-like channel expressed in nociceptive neurons

Examples

Experimental program
Comparison scheme
Effect test

example 1

Molecular Cloning of ANKTM1

[0187] Bioinformatic searches were done as previously described (Peier et al., 2002a, supra; Peier et al., 2002b, supra). Sequence analysis was performed using the Biology Workbench at the San Diego Supercomputing Center. A 902-base pair fragment of the mouse homologue of ANKTM1 was amplified from newborn mouse DRG cDNA using the following primers:

(SEQ ID NO:9)mANK-like F2 (5′-AGTGGGGAGACTACCCTGTG)and(SEQ ID NO:10)mANK-like R2 (5′-TTTATCATGCCCATTCTTTGC).

[0188] From this initial sequence and subsequent hits to DNA databases, the following primers were designed to PCR-amplify full-length ANKTM1 from adult mouse trigeminal ganglia cDNA:

mANK-like start(SEQ ID NO:11)(5′TTTGGATCCGCCACCATGAAGCGCGGCTTGAGGAGG)andmANK-like stop(SEQ ID NO 12)(5′TTTGCGGCCGCCTAAAAGTCCGGGTGGCTAATAGAAC).

EXAMPLE 3

Expression Analysis

[0189] Overall tissue distribution of ANKTM1 was analyzed by Northern blot analysis using a probe corresponding to nucleotides 590-1492 of mouse ANKTM...

example 3

Double In-Situ Hybridization Studies

[0192] The expression of ANKTM1 relative to known thermo-activated TRP channels was also studied. TRPV1 (VR1) is a well-characterized receptor for noxious heat, pH, and capsaicin. For double in-situ hybridizations, sections were hybridized with in vitro transcribed digoxigenin- or fluorescein-labeled cRNA probes (Roche, Basel, Switzerland) corresponding to nucleotides 590-1492 of mANKTM1, and nucleotides 1410-1980 of mTRPM8 (NM—029310) (SEQ ID NO:14). We used two cRNA probes corresponding to bases 1516-2065 or 1516-2482 of TRPV1 sequence (AF029310). Both probes showed consistent patterns of hybridization. Peroxidase-conjugated anti-digoxigenin-POD (1:500) and alkaline phosphatase-conjugated anti-fluorescein (1:2000) antibodies (Roche) were used to detect hybridized cRNA probes and visualized using tyramide signal amplification (TSA; NEN) and fast-red detection (Roche) systems, respectively. The immunostaining experiments followed hybridization o...

example 4

CHO Cell Expression System

[0195] Nevertheless, since ANKTM1 bears similarities to TRP-like channels expressed in sensory neurons, tests were conducted to determine activation of ANKTM1 by various sensory stimuli. To this end, a series of tests were conducted using full-length murine ANKTM1 stably transfected in Chinese Hamster Ovary (CHO) cells containing FRT sites (CHO-K1 / FRT) under control of a tetracycline (Tet)-inducible promoter via Flp recombinase mediated recombination.

[0196] CHO-K1 / FRT cells were stably transfected with full-length murine ANKTM1 in the pcDNA5 / FRT vector using Lipofectamine (Invitrogen) according to the manufacturer's protocol. Transfected cells were selected in growth medium containing Hygromycin (200 μg / mL). Northern blot analysis identified stable clones expressing ANKTM1 mRNA. The generation of stable murine TRPM8-expressing CHO-K1 / FRT cells has been previously described (Peier et al, 2002). ANKTM1-expressing stable CHO-K1 / FRT lines appeared unhealthy ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Temperatureaaaaaaaaaa
Dissociation constantaaaaaaaaaa
Login to View More

Abstract

The methods and compositions of the invention are based on a method for measuring nociceptive responses in vertebrates, including humans and other mammals utilizing a newly discovered thermoreceptor belonging to the Transient Receptor Potential (TRP) family of non-selective cation channels that participates in thermosensation and pain. This receptor, designated ANKTMI, is associated with nociceptive pain, such as hyperalgesia. Accordingly, the invention provides isolated polypeptides and polynucleotides associated with nociception as well as methods for identifying or screening agents that modulate nociception.

Description

ACKNOWLEDGMENT OF GOVERNMENT SUPPORT [0001] This invention was made in part with government support under NINDS Grant No. R01NS42822 awarded by the National Institutes of Health. The federal government may have certain rights in this invention.FIELD OF THE INVENTION [0002] The invention relates generally to nociceptive pain and disorders associated with pain and more specifically to polynucleotides encoding polypeptides that affect nociceptive pain and methods for use therefor. BACKGROUND [0003] Pain has been defined in a variety of ways. For example, pain can be defined as the perception by a subject of noxious stimuli that produces a withdrawal reaction by the subject. The most commonly experienced form of pain may be defined as the effect of a stimulus on nerve endings, which results in the transmission of impulses to the cerebrum. This somatic sensation and normal function of pain, referred to as nociception or nociceptive pain, informs the organism of impending tissue damage. S...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/705C12Q1/68A01K67/00C12P21/06C12N15/63C07H21/04G01N33/50
CPCA01K2217/05A01K2217/075A01K2227/10C07K14/705G01N33/5088A61P25/00
Inventor BEVAN, STUARTPATAPOUTIAN, ARDEMSTORY, GINA
Owner NOVARTIS AG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More