Unlock instant, AI-driven research and patent intelligence for your innovation.

Platelet-derived growth factor D, DNA coding therefor, and uses thereof

a growth factor and platelet technology, applied in the field of platelet-derived growth factor d, can solve the problems of cardiovascular failure, fluid accumulation in the pericardial cavity, and embyonic lethality around midgestation, and achieve the effect of efficient high-volume screening

Inactive Publication Date: 2007-02-22
LUDWIG INST FOR CANCER RES +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention provides a novel growth factor called PDGF-D, which can stimulate and enhance the growth and motility of cells expressing its receptor. The growth factor is encoded by a polynucleotide sequence that has at least 85% identity to a specific sequence. The growth factor is structurally homologous to other growth factors in the PDGF family, such as PDGF-A, PDGF-B, and PDGF-C. The growth factor can be used for therapeutic and diagnostic purposes. It can be administered as a naked polynucleotide or in a vector or liposome. The growth factor has the ability to stimulate the growth and differentiation of cells expressing its receptor, including endothelial cells, connective tissue cells, myofibroblasts, and glial cells. A preferred fragment of the growth factor is a truncated form of PDGF-D that includes the PDGF / VEGF homology domain. Another preferred fragment is a truncated form of PDGF-D that includes only the CUB domain.

Problems solved by technology

Disruption of the VEGFR genes results in aberrant development of the vasculature leading to embryonic lethality around midgestation.
Inactivation of VEGFR-3 results in cardiovascular failure due to abnormal organization of the large vessels (Dumont et al.
Targeted inactivation of both copies of the VEGFR-3 gene in mice resulted in defective blood vessel formation characterized by abnormally organized large vessels with defective lumens, leading to fluid accumulation in the pericardial cavity and cardiovascular failure at post-coital day 9.5.
However, the role of VEGFR-3 in the development of the lymphatic vasculature could not be studied in these mice because the embryos died before the lymphatic system emerged.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Platelet-derived growth factor D, DNA coding therefor, and uses thereof
  • Platelet-derived growth factor D, DNA coding therefor, and uses thereof
  • Platelet-derived growth factor D, DNA coding therefor, and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Expression of Human PDGF-D in Baculovirus Infected Sf9 Cells

[0129] The portion of the cDNA encoding amino acid residues 24-370 of SEQ ID NO:8 was amplified by PCR using Taq DNA polymerase (Biolabs). The forward primer used was 5′GATATCTAGAAGCAACCCCGCAGAGC 3′ (SEQ ID NO:33). This primer includes a XbaI site (underlined) for in frame cloning. The reverse primer used was 5′ GCTCGAATTCTAAATGGTGATGGTGATGATG TCGAGGTGGTCTTGA 3′ (SEQ ID NO:34). This primer includes an EcoRI site (underlined) and sequences coding for a C-terminal 6×His tag preceded by an enterokinase site. The PCR product was digested with XbaI and EcoRI and subsequently cloned into the baculovirus expression vector, pAcGP67A. Verification of the correct sequence of the cloned PCR product was done by nucleotide sequencing. The expression vectors were then co-transfected with BaculoGold linearized baculovirus DNA into Sf9 insect cells according to the manufactures protocol (Pharmingen). Recombined baculovirus were amplified ...

example 2

Generation of Antibodies to Human PDGF-D

[0132] Rabbit antisera against full-length PDGF-DD and against a synthetic peptide derived from the PDGF-D sequence (residues 254-272, amino acid sequence RKSKVDLDRLNDDAKRYSC of SEQ ID NO:36) were generated. These peptides were each conjugated to the carrier protein keyhole limpet hemocyanin (KLH, Calbiochem) using N-succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Pharmacia Inc.) according to the instructions of the supplier. 200-300 micrograms of the conjugates in phosphate buffered saline (PBS) were separately emulsified in Freunds Complete Adjuvant and injected subcutaneously at multiple sites in rabbits. The rabbits were boostered subcutaneously at biweekly intervals with the same amount of the conjugates emulsified in Freunds Incomplete Adjuvant. Blood was drawn and collected from the rabbits. The sera were prepared using standard procedures known to those skilled in the art. The antibodies to full-length PDGF-DD were affinity-purifie...

example 3

Expression of PDGF-D Transcripts

[0134] To investigate the tissue expression of PDGF-D in several human tissues, a Northern blot was done using a commercial Multiple Tissue Northern blot (MTN, Clontech). The blots were hybridized at according to the instructions from the supplier using ExpressHyb solution at 68° C. for one hour (high stringency conditions), and probed sequentially with a 32P-labeled 327 bp PCR-generated probe from the human fetal lung cDNA library (see description above) and full-length PDGF-B cDNA. The blots were subsequently washed at 50° C. in 2×SSC with 0.05% SDS for 30 minutes and at 50° C. in 0.1×SSC with 0.1% SDS for an additional 40 minutes. The blots were then put on film and exposed at −70° C. As shown in FIG. 15, upper panel, the highest expression of a major 4.4 kilobase (kb) transcript occurred in heart, pancreas and ovary while lower expression levels were noted in several other tissues including placenta, liver, kidney, prostate, testis, small intesti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
temperatureaaaaaaaaaa
pHaaaaaaaaaa
Login to View More

Abstract

PDGF-D, a new member of the PDGF / VEGF family of polypeptide growth factors, is described, as well as nucleotide sequences encoding, methods for producing, pharmaceutical compositions containing this new growth factor, and its antibodies and other antagonists. Also disclosed are transfected and transformed host cells expressing PDGF-D, and uses thereof in medical and diagnostic applications.

Description

CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application is a division of application Ser. No. 10 / 086,623, filed Mar. 4, 2002, which is a continuation-in-part of U.S. application Ser. No. 09 / 691,200, filed Oct. 19, 2000, which is a continuation-in-part of U.S. application Ser. No. 09 / 438,046, filed Nov. 10, 1999 and claims the benefit of U.S. Provisional Application No. 60 / 107,852, filed Nov. 10, 1998; U.S. Provisional Application No. 60 / 113,997, filed Dec. 28, 1998; U.S. Provisional Application No. 60 / 150,604, filed Aug. 26, 1999; U.S. Provisional Application No. 60 / 157,108, filed Oct. 4, 1999; and U.S. Provisional Application No. 60 / 157,756, filed Oct. 5, 1999, the disclosures of which are hereby incorporated by reference in their entireties into the present application.FIELD OF THE INVENTION [0002] This invention relates to growth factors for cells expressing receptors to a novel growth factor that include endothelial cells, connective tissue cells (such as fibroblasts) my...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12Q1/68C07H21/04C12P19/34A61K38/00C07K14/49
CPCA61K38/00C07K14/49C12Q1/6886C12Q2600/158
Inventor ERIKSSON, ULFAASE, KARINLI, XURIPONTEN, ANNICAUUTELA, MARKOALITALO, KARIOESTMAN, ARNEHELDIN, CARL-HENRIK
Owner LUDWIG INST FOR CANCER RES