Method for determining base sequence of DNA

a technology of dna and base sequence, applied in the field of determining the base sequence of dna, can solve the problems of enormous cost and effort, and achieve the effect of short tim

Inactive Publication Date: 2010-01-14
NAT UNIV HOKKAIDO UNIV 10 +1
View PDF7 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides a method for determining the base sequence of a DNA without the need for cloning, using a probe with a one-base-protruding end and a recognition sequence of a restriction enzyme. This method allows for the identification of the species of the identification label of the probe without the need for single molecule observation. The method can be carried out quickly and easily, and does not require the use of a fluorescent label. The distance between the recognition sequence of the restriction enzyme and the protruding end on the probe is one base shorter than the distance between the recognition sequence and the cleavage site for the restriction enzyme. The method can be used to determine the base sequence of a plurality of DNAs simultaneously. The patent text also provides a list of enzymes that can be used for the method.

Problems solved by technology

Thus, with the DNA base sequence determination method that has been used in prior art, there is the problem that considerable effort and time, and enormous costs are necessary in order to determine the base sequence of a DNA.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for determining base sequence of DNA
  • Method for determining base sequence of DNA
  • Method for determining base sequence of DNA

Examples

Experimental program
Comparison scheme
Effect test

example 1

Incorporation of a Sequence-Specific Fluorescent Probe in a Multimolecular System

[0133]The base sequence of a DNA was determined by detecting a fluorescent DNA probe that binds specifically to the sequence of a DNA having a one base-protruding end and further reacting alternately a Class IIS restriction enzyme and a DNA ligase.

(1) Immobilization of DNA to be Analyzed onto a Support

[0134]Biotinylated DNA comprising biotin conjugated to the DNA to be analyzed (FIG. 3) (SEQ ID No.: 9: 5′ biotin-GCTACGTAAGCTTCATGAATTCGACACTGTGTCAGCA 3′, SEQ ID No.: 10: 5′ GCTGACACAGTGTCGAATTCATGAAGCTTACGTAGC 3′) (10 μM) was mixed with avidin-agarose beads (Sigma, A9207) (suspended with 1×PBS into a 30 μl slurry) and admixed for one hour to immobilize the DNA to be analyzed onto avidin-agarose beads.

(2) Ligation of the DNA to be Analyzed and Fluorescent DNA Probes

[0135]Beads having the DNA to be analyzed obtained immobilized in (1) above were washed twice with 1×PBS, further washed once with a T4 DNA lig...

example 2

[0144]A combination of base sequences of DNA was analyzed by single molecule observation of a chain reaction by a restriction enzyme and a ligase.

(1) Preparation of Quantum Dot-DNA Probes

[0145]Using a crosslinking agent (EDC), quantum dots (525 and 605) (Q21341MP Qdot (registered trade mark) 525 ITK™ Carboxyl Quantum Dots, and Q21301MP Qdot (registered trade mark) 605 ITK™ Carboxyl Quantum Dots, Invitrogen Corporation) were respectively bound covalently to the amino groups at 5′ of the DNAs described below to prepare quantum dot-DNA probes.

Quantum dot 525 (FIG. 5 (1a)):SEQ ID No.: 11: 5′ cgtcccagtactagtatgc 3′SEQ ID No.: 12: 5′ amine-gcatactagtactgggacgc 3′Quantum dot 605 (FIG. 5 (1b)):SEQ ID No.: 13: 5′ cgtcccagtactagtatgc 3′SEQ ID No.: 14: 5′ amine-gcatactagtactgggacgt 3′

(2) Immobilization of the DNAs to be Analyzed onto a Support

[0146]First, avidin (Sigma, A9275) was immobilized on the surface of a cover glass. Biotinylated DNA comprising biotin bonded to the DNA to be analyzed (...

example 3

[0149]The base sequence of a DNA was identified by way of single molecule observation of a chain reaction by a restriction enzyme and a ligase, using a support with a plurality of DNAs to be analyzed immobilized.

(1) Phosphorylation of Oligo DNA

[0150]Added with 22 μl of 10× T4 polynucleotide kinase buffer (NEB), 5 μl of ATP (100 mM) and 10 μl of T4 polynucleotide kinase (NEB), 200 μl of oligo DNA (50 μmol / μl) (Hokkaido System Science) was incubated at 37° C. for five hours. After incubation, phenol extraction (phenol: chloroform=1:1, stirring with a Vortex mixer for 10 seconds), chloroform wash (stirring with a Vortex mixer for 10 seconds), isopropanol precipitation (treatment for one minute with 50% isopropanol and 0.3M acetic acid sodium at room temperature, then centrifugation at 20000×g for 15 minute at 4° C.), and 70% ethanol wash (treatment with 1000 μl, then, centrifugation at 20000×g; number of washes: once) were carried out. After washing, [the oligo DNA] was dissolved in 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
pHaaaaaaaaaa
distanceaaaaaaaaaa
Login to View More

Abstract

The present invention provides a method for determining the base sequence of a DNA. According to the method for determining the base sequence of a DNA of the present invention, a probe is used, which is a probe having a protruding end and identification-labeled according to the species of the base at the protruding end, containing a recognition sequence of a class IIS restriction enzyme, to carry out simultaneously in a chain reaction, for a plurality of DNAs to be analyzed, ligation of the end base of a DNA to be analyzed and a probe and cleavage of the end base of the DNA to be analyzed, allowing the base sequence to be determined sequentially by a single molecule spectrofluorimetry method, such that an effective determination of the base sequence of a DNA becomes possible.

Description

TECHNICAL FIELD[0001]The present invention relates to a method for determining the base sequence of a DNA. More specifically, the present invention relates to a method in which a DNA base deletion chain reaction by a restriction enzyme and a DNA ligase is detected at a single molecule level to determine the base sequence of a DNA.BACKGROUND[0002]From prior art, the Maxam-Gilbert method and the Sanger method are known as methods for determining the base sequence of a DNA. For instance, in the Maxam-Gilbert method, steps such as the following are required, for example, to determine the base sequence of a DNA.[0003](1) Fragmenting DNA extracted from cells and integrating a DNA fragment into Escherichia coli, or the like, using a gene recombination technique, or the like.[0004](2) Culturing Escherichia coli, or the like, to amplify the integrated DNA fragment (cloning).[0005](3) Lysing Escherichia coli or the like, separating biochemically the integrated DNA fragment, and carrying out o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68C07H21/04C12M1/34
CPCC12Q1/6869C12Q2563/107C12Q2521/313C12Q2521/501
InventorNAGAI, TAKEHARUTANI, TOMOMIKOTERA, IPPEIYONEDA, YOSHIHIRO
OwnerNAT UNIV HOKKAIDO UNIV 10