Colon cancer microsatellite instability detection kit based on next generation sequencing platform
A detection kit and next-generation sequencing technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of low sensitivity, low specificity and repeatability, complicated operation, etc. High specificity and high throughput
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0043] The colon cancer microsatellite instability detection kit based on the next-generation sequencing platform includes 5 μl of primer panel solution, and the concentration of the primer panel solution is 50 mmol / L.
[0044] The primer panel includes primers for 10 microsatellite loci, and the sequences of the forward primer and the reverse primer are as follows:
[0045] site
Forward primer (F)
reverse primer (R)
NR-21
TCGCTGGCACAGTTCTATTT
TGTTTGTAAACGCGAGTGAC
NR-22
TAATCGAGGCTTGTCAAGGA
GTCTGGAAGTTTTGTCTTGG
NR-24
TGCTGAATTTTACCTCCTGA
AGGTTGGAATGCAATGGCAC
NR-27
CCATGCTTGCAAACCACTGG
TTGGTCATTGCTAGTATTAT
BAT-25
TCGAACTGTCACCTCGGCTTT
ACTTCAAAAATGACATTCTG
BAT-26
TGACACTTTTTGACTTCAGCC
AACCATTCAACATTTTTAACC
MONO-27
GATTGCAGTGAGCTGAG
TAGCCTTAGAATGTTAGC
D2S123
AAACAGGATGCCTGCCTTTA
GGACCTTCCACCTATGGGAC
D5S346
CGTGAACAGGAGCTTCATCG
ATCTG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
