Compositions and methods for the treatment of hemoglobinopathies

a technology for hemoglobinopathies and compositions, applied in the field of genetic diseases, can solve the problems of unpaired -like chains, significant health burden worldwide, and unpaired -like chains, and achieve the effects of enhancing the survival and proliferation of hematopoietic stem/progenitor, enhancing the expansion of long-term repopulating cells, and efficient engrafting of corrected cells

Inactive Publication Date: 2015-06-18
NAT INST OF HEALTH DIRECTOR DEITR
View PDF0 Cites 82 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent text describes a method for using gene-targeting techniques to treat genetic disorders, such as β-thalassemia. The method involves using homing endonucleases or CRISPR endonucleases to disrupt a specific regulatory sequence in the β-globin gene locus, which can increase the expression of other genes, such as γ- or δ-globin genes. The use of these techniques is not patient-specific, which makes it easier to treat patients with the disorder. The patent also describes methods for expanding hematopoietic stem cells and using them for gene-modification and clinical application. These techniques may involve the use of growth factors and other reagents to enhance the survival and proliferation of hematopoietic stem / progenitor cells. Overall, the patent provides new tools for treating genetic disorders and expanding stem cells for therapeutic purposes.

Problems solved by technology

Hemoglobinopathies, such as thalassemias and sickle cell disease, are highly prevalent genetic red blood sell disorders that cause a significant health burden worldwide.
Thus α abnormalities manifest in utero, potentially with devastating consequences (e.g. hydrops fetalis).
β-thalassemia is caused by an abnormality in the adult β-globin locus, which results in an abnormal stoichiometry of β-like globin chains to α-like chains, resulting in the precipitation of the unpaired α-like chains.
The ensuing damage meditated through several pathways including oxidation of cellular and membrane proteins culminates in ineffective erythropoiesis, apoptosis, and decreased red cell survival.
The hydrophobic valine at position 6 of the hemoglobin β-chain forms a hydrophobic patch which can associate with the hydrophobic patch of other hemoglobin S molecules causing hemoglobin S molecules to aggregate and form fibrous precipitates which, in turn, cause the red blood cells to adopt a sickle-shape and leads to alterations in numerous pathways that result in tissue damage via vaso-occlusion and hemolyis.
Severe forms of thalassemia require chronic transfusions, resulting in iron overload.
Survival directly correlates with the efficacy of chelation, though cost, side effects, and compliance severely limit efficacy.
This treatment, however, is under-prescribed, compliance is poor, and it does not adequately protect health.
Allogeneic hematopoietic cell transplantation (HCT) from HLA-matched sibling or unrelated donors offers a cure for patients with hemoglobinopathies, but is limited by the need for a suitably matched related or unrelated donor and is complicated by graft versus host disease (GVHD) and infections.
In addition, a major barrier is a high rate of graft failures, which is higher than observed for HCT for malignancies.
Unfortunately, several factors, including the low cell dose available in many cord blood units lead to slow engraftment and an increase in transplant related mortality in adults and larger children.
Similarly, these low cell numbers correlate with higher rates of graft failure, thus a particular concern in hemoglobinopathies where there is already high risk of graft failure.
The majority of the NRM occurs within the first 100 days post transplant with infection being the most common cause of death.
Thus, the significant delay in myeloid recovery that is observed in CBT recipients remains a critical barrier to successful outcomes in the CBT setting.
Despite tremendous investment of resources by many laboratories for over 30 years, there has been little progress in the development of therapeutic regimens for hemoglobinopathies, in large part due to the lack of identified drugable targets and the requirement for gene therapy vectors to persistently express at extremely high levels, while not leading to insertional mutagenesis.
While increased expression of fetal hemoglobin (HbF) ameliorates both hemoglobinopathies, extensive research has not yielded viable new agents based on that observation.
HSC gene therapy, however, requires high-level persistent expression and carries a substantial / risk of insertional mutagenesis and leukemia.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods for the treatment of hemoglobinopathies
  • Compositions and methods for the treatment of hemoglobinopathies
  • Compositions and methods for the treatment of hemoglobinopathies

Examples

Experimental program
Comparison scheme
Effect test

example 1

Selection of Bcl11a Gene Targeting Homing Endonucleases Based on I-HjeMI, I-CpaMI, and I-OnuI Using In Vitro Compartmentalization (IVC)

[0157]The open reading frame (ORF) of a parental LAGLIDADG homing endonuclease (LHE), I-HjeMI (FIG. 14; SEQ ID NO: 28; Jacoby et al., Nucl. Acids Res. 40(11):4954-4964 (2012), Taylor et al., Nucl. Acids Res. 40(Web Server issue): W110-6 (2012)), codon optimized for expression in E. coli, was cloned between the NcoI and NotI restriction sites of pET21-a(+) (FIG. 11; EMD Millipore (Novagen) division of Merck KGaA. To introduce site-directed saturation mutagenesis into the ORF of I-HjeMI, DNA fragments containing its partial ORF with approximately 20 base pairs of a region overlapped with flanking fragments on both sides were PCR-amplified using primers that contained degenerate codon 5′-NNK-3′ (coding all 20 amino acids). Amino-acid residues mutated using such PCR primers are shown in Table 2. PCR products were purified by extraction from an agarose ge...

example 2

Optimization of Activity of BCL11A Gene-Targeting I-HjeMI Variants Using Two-Plasmid Gene Elimination Cleavage Assay in Bacteria

[0163]The activity of I-HjeMI variants obtained in selection using IVC display selections (disclosed in Example 1, above) was optimized using a two-plasmid selection system in bacterial cells according to the methodology of Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006). The ORF of the endonuclease genes was inserted between NcoI and NotI sites of the pENDO (FIG. 12, Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006) expression plasmid. NovaXGF (EMD Millipore (Novagen)) competent cells harboring the pCcdB reporter plasmid (FIG. 31, Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006); Takeuchi et al., Nucl. Acids Res. 37(3)877-8890 (2009); and Takeuchi et al., Proc. Natl. Acad Sci. U.S.A. 10.1073 / pnas.1107719108 (2011)) containing 4 copies of the BCL11A gene target were transformed with a pool of the pEndo plasmid encoding I-HjeMI variants....

example 3

Activity of BCL11A Gene-Targeting Endonucleases Tested in a Two-Plasmid Cleavage Assay

[0165]Activity of an exemplary BCL11A gene-targeting endonuclease (BCL11Ahje; FIG. 17, SEQ ID NO: 31), its catalytically inactive variant (BCL11Ahje D18N), and its parental LHE I-HjeMI (FIG. 14, SEQ ID NO: 28) was measured in bacterial cells that harbor the pCcdB reporter plasmid (Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006)) containing 4 copies of either the target site for I-HjeMI (I-HjeMI target) or the BCL11A gene target (TCCAAGTGATGTCTCGGTGGTG (SEQ ID NO: 39; underlined nucleotides differ from those in the target site for the parental LHE I-HjeMI). The pCcdB reporter plasmid encodes “control of cell death B” (“ccdB”, a toxic protein in bacteria, which is inducible by an addition of IPTG). Cleavage of the target sites in the reporter plasmid leads to RecBCD-mediated degradation of the reporter plasmid and corresponding cell survival on the selective medium containing IPTG. The surviv...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
compositionaaaaaaaaaa
sizeaaaaaaaaaa
Login to View More

Abstract

Provided are compositions and methods for the treatment of hemoglobinopathies such as thalassemias and sickle cell disease. Compositions and methods include one or more endonuclease(s) or endonuclease fusion protein(s), including one or more homing endonuclease(s) and / or homing endonuclease fusion protein(s) and / or CRISPR endonuclease(s) ad / or CRISPR endonuclease fusion protein(s): (a) to disrupt a Bcl11a coding region; (b) to disrupt a Bcl11a gene regulatory region; (c) to modify an adult human β-globin locus; (d) to disrupt a HbP silencing DNA regulatory element or pathway, such as a Bcl11a-regulated HbP silencing region; (e) to mutate one or more γ-globin gene promoter(s) to achieve increased expression of a γ-globin gene; (f) to mutate one or more δ-globin gene promoter(s) to achieve increased expression of a δ-globin gene; and / or (g) to correct one or more β-globin gene mutation(s).

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]This application is being filed on 22 Feb. 2013, as a PCT International patent application, and claims priority to U.S. Provisional Patent Application No. 61 / 603,231, filed Feb. 24, 2012, the disclosure of which is hereby incorporated by reference herein in its entirety.SEQUENCE LISTING[0002]The present application includes a Sequence Listing in electronic format as a txt file entitled “sequence listing 54428.0006WOUI_ST25” and crested on Feb. 22, 2013 and which has a size of 174 kilobytes (KB). The contents of the txt file “sequence listing 54428.0006WOUI_ST25” are incorporated by reference herein.BACKGROUND OF THE DISCLOSURE[0003]1. Technical Field of the Disclosure[0004]The present disclosure relates, generally, to the treatment of genetic diseases. More specifically, the present disclosure provides endonuclease-based compositions and methods, including homing endonuclease- and Cas9 endonuclease-based compositions and methods, for alte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N9/16
CPCC12N9/16A61K38/465C12N9/22A61P7/00A61P7/06A61K48/00C07K2319/80
InventorTAKEUCHI, RYOGROUDINE, MARK TSTODDARD, BARRY L.BENDER, MICHAEL A
OwnerNAT INST OF HEALTH DIRECTOR DEITR