Compositions and methods for the treatment of hemoglobinopathies

Abstract

Provided are compositions and methods for the treatment of hemoglobinopathies such as thalassemias and sickle cell disease. Compositions and methods include one or more endonuclease(s) or endonuclease fusion protein(s), including one or more homing endonuclease(s) and / or homing endonuclease fusion protein(s) and / or CRISPR endonuclease(s) ad / or CRISPR endonuclease fusion protein(s): (a) to disrupt a Bcl11a coding region; (b) to disrupt a Bcl11a gene regulatory region; (c) to modify an adult human β-globin locus; (d) to disrupt a HbP silencing DNA regulatory element or pathway, such as a Bcl11a-regulated HbP silencing region; (e) to mutate one or more γ-globin gene promoter(s) to achieve increased expression of a γ-globin gene; (f) to mutate one or more δ-globin gene promoter(s) to achieve increased expression of a δ-globin gene; and / or (g) to correct one or more β-globin gene mutation(s).

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is being filed on 22 Feb. 2013, as a PCT International patent application, and claims priority to U.S. Provisional Patent Application No. 61 / 603,231, filed Feb. 24, 2012, the disclosure of which is hereby incorporated by reference herein in its entirety.SEQUENCE LISTING

[0002] The present application includes a Sequence Listing in electronic format as a txt file entitled “sequence listing 54428.0006WOUI_ST25” and crested on Feb. 22, 2013 and which has a size of 174 kilobytes (KB). The contents of the txt file “sequence listing 54428.0006WOUI_ST25” are incorporated by reference herein.BACKGROUND OF THE DISCLOSURE

[0003] 1. Technical Field of the Disclosure

[0004] The present disclosure relates, generally, to the treatment of genetic diseases. More specifically, the present disclosure provides endonuclease-based compositions and methods, including homing endonuclease- and Cas9 endonuclease-based compositions and methods, for alte...

Examples

example 1

Selection of Bcl11a Gene Targeting Homing Endonucleases Based on I-HjeMI, I-CpaMI, and I-OnuI Using In Vitro Compartmentalization (IVC)

[0157]The open reading frame (ORF) of a parental LAGLIDADG homing endonuclease (LHE), I-HjeMI (FIG. 14; SEQ ID NO: 28; Jacoby et al., Nucl. Acids Res. 40(11):4954-4964 (2012), Taylor et al., Nucl. Acids Res. 40(Web Server issue): W110-6 (2012)), codon optimized for expression in E. coli, was cloned between the NcoI and NotI restriction sites of pET21-a(+) (FIG. 11; EMD Millipore (Novagen) division of Merck KGaA. To introduce site-directed saturation mutagenesis into the ORF of I-HjeMI, DNA fragments containing its partial ORF with approximately 20 base pairs of a region overlapped with flanking fragments on both sides were PCR-amplified using primers that contained degenerate codon 5′-NNK-3′ (coding all 20 amino acids). Amino-acid residues mutated using such PCR primers are shown in Table 2. PCR products were purified by extraction from an agarose ge...

example 2

Optimization of Activity of BCL11A Gene-Targeting I-HjeMI Variants Using Two-Plasmid Gene Elimination Cleavage Assay in Bacteria

[0163]The activity of I-HjeMI variants obtained in selection using IVC display selections (disclosed in Example 1, above) was optimized using a two-plasmid selection system in bacterial cells according to the methodology of Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006). The ORF of the endonuclease genes was inserted between NcoI and NotI sites of the pENDO (FIG. 12, Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006) expression plasmid. NovaXGF (EMD Millipore (Novagen)) competent cells harboring the pCcdB reporter plasmid (FIG. 31, Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006); Takeuchi et al., Nucl. Acids Res. 37(3)877-8890 (2009); and Takeuchi et al., Proc. Natl. Acad Sci. U.S.A. 10.1073 / pnas.1107719108 (2011)) containing 4 copies of the BCL11A gene target were transformed with a pool of the pEndo plasmid encoding I-HjeMI variants....

example 3

Activity of BCL11A Gene-Targeting Endonucleases Tested in a Two-Plasmid Cleavage Assay

[0165]Activity of an exemplary BCL11A gene-targeting endonuclease (BCL11Ahje; FIG. 17, SEQ ID NO: 31), its catalytically inactive variant (BCL11Ahje D18N), and its parental LHE I-HjeMI (FIG. 14, SEQ ID NO: 28) was measured in bacterial cells that harbor the pCcdB reporter plasmid (Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006)) containing 4 copies of either the target site for I-HjeMI (I-HjeMI target) or the BCL11A gene target (TCCAAGTGATGTCTCGGTGGTG (SEQ ID NO: 39; underlined nucleotides differ from those in the target site for the parental LHE I-HjeMI). The pCcdB reporter plasmid encodes “control of cell death B” (“ccdB”, a toxic protein in bacteria, which is inducible by an addition of IPTG). Cleavage of the target sites in the reporter plasmid leads to RecBCD-mediated degradation of the reporter plasmid and corresponding cell survival on the selective medium containing IPTG. The surviv...

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is being filed on 22 Feb. 2013, as a PCT International patent application, and claims priority to U.S. Provisional Patent Application No. 61 / 603,231, filed Feb. 24, 2012, the disclosure of which is hereby incorporated by reference herein in its entirety.SEQUENCE LISTING

[0002] The present application includes a Sequence Listing in electronic format as a txt file entitled “sequence listing 54428.0006WOUI_ST25” and crested on Feb. 22, 2013 and which has a size of 174 kilobytes (KB). The contents of the txt file “sequence listing 54428.0006WOUI_ST25” are incorporated by reference herein.BACKGROUND OF THE DISCLOSURE

[0003] 1. Technical Field of the Disclosure

[0004] The present disclosure relates, generally, to the treatment of genetic diseases. More specifically, the present disclosure provides endonuclease-based compositions and methods, including homing endonuclease- and Cas9 endonuclease-based compositions and methods, for alte...

Examples

example 1

Selection of Bcl11a Gene Targeting Homing Endonucleases Based on I-HjeMI, I-CpaMI, and I-OnuI Using In Vitro Compartmentalization (IVC)

[0157]The open reading frame (ORF) of a parental LAGLIDADG homing endonuclease (LHE), I-HjeMI (FIG. 14; SEQ ID NO: 28; Jacoby et al., Nucl. Acids Res. 40(11):4954-4964 (2012), Taylor et al., Nucl. Acids Res. 40(Web Server issue): W110-6 (2012)), codon optimized for expression in E. coli, was cloned between the NcoI and NotI restriction sites of pET21-a(+) (FIG. 11; EMD Millipore (Novagen) division of Merck KGaA. To introduce site-directed saturation mutagenesis into the ORF of I-HjeMI, DNA fragments containing its partial ORF with approximately 20 base pairs of a region overlapped with flanking fragments on both sides were PCR-amplified using primers that contained degenerate codon 5′-NNK-3′ (coding all 20 amino acids). Amino-acid residues mutated using such PCR primers are shown in Table 2. PCR products were purified by extraction from an agarose ge...

example 2

Optimization of Activity of BCL11A Gene-Targeting I-HjeMI Variants Using Two-Plasmid Gene Elimination Cleavage Assay in Bacteria

[0163]The activity of I-HjeMI variants obtained in selection using IVC display selections (disclosed in Example 1, above) was optimized using a two-plasmid selection system in bacterial cells according to the methodology of Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006). The ORF of the endonuclease genes was inserted between NcoI and NotI sites of the pENDO (FIG. 12, Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006) expression plasmid. NovaXGF (EMD Millipore (Novagen)) competent cells harboring the pCcdB reporter plasmid (FIG. 31, Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006); Takeuchi et al., Nucl. Acids Res. 37(3)877-8890 (2009); and Takeuchi et al., Proc. Natl. Acad Sci. U.S.A. 10.1073 / pnas.1107719108 (2011)) containing 4 copies of the BCL11A gene target were transformed with a pool of the pEndo plasmid encoding I-HjeMI variants....

example 3

Activity of BCL11A Gene-Targeting Endonucleases Tested in a Two-Plasmid Cleavage Assay

[0165]Activity of an exemplary BCL11A gene-targeting endonuclease (BCL11Ahje; FIG. 17, SEQ ID NO: 31), its catalytically inactive variant (BCL11Ahje D18N), and its parental LHE I-HjeMI (FIG. 14, SEQ ID NO: 28) was measured in bacterial cells that harbor the pCcdB reporter plasmid (Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006)) containing 4 copies of either the target site for I-HjeMI (I-HjeMI target) or the BCL11A gene target (TCCAAGTGATGTCTCGGTGGTG (SEQ ID NO: 39; underlined nucleotides differ from those in the target site for the parental LHE I-HjeMI). The pCcdB reporter plasmid encodes “control of cell death B” (“ccdB”, a toxic protein in bacteria, which is inducible by an addition of IPTG). Cleavage of the target sites in the reporter plasmid leads to RecBCD-mediated degradation of the reporter plasmid and corresponding cell survival on the selective medium containing IPTG. The surviv...

Images