Unlock instant, AI-driven research and patent intelligence for your innovation.

Tomato RNA virus host factor and its coding gene and use thereof

An anti-virus and tomato technology, applied in botany equipment and methods, biochemical equipment and methods, plant peptides, etc., can solve the problems that viruses cannot replicate or the efficiency of replication is reduced

Inactive Publication Date: 2008-11-12
GUANGXI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If these host factors are lacking in the host cell, the virus cannot replicate or the efficiency of replication is greatly reduced (Ahlquist P., Noueiry, A.O., and Lee, W.M., et al., 2003.Host Factor in Positive-Strand RNA Viruses Genome Replication. Journal of Virology, 77(15): 8181-8126.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tomato RNA virus host factor and its coding gene and use thereof
  • Tomato RNA virus host factor and its coding gene and use thereof
  • Tomato RNA virus host factor and its coding gene and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, the cloning of the full-length cDNA sequence of tomato host factor gene ToTOM1

[0050] 1. Cloning of ToTOM1 3' end cDNA

[0051] According to the tomato EST sequence BE458681 (528nt)[gi:9502983] found in GenBank that has a certain homology with Arabidopsis AtTOM1[gi:9967414], two forward primers were designed to amplify the cDNA sequence at the 3' end of ToTOM1. The primer sequences are as follows :

[0052] Tomato Tom1-A: 5'CTCCCTTTGTGCTTCC-TATGGTCT 3';

[0053] Tomato Tom1-1: 5'GGGTACCCGAGTATGGCTGGACAAC 3'

[0054] The cDNA sequence at the 3' end of ToTOM1 was synthesized using the 3'RACE System for Rapid Aplication of cDNA Ends kit (Invitrogen, catalog number 18373-027). The total RNA of tomato was extracted, and its first-strand cDNA was synthesized by reverse transcription. Using the first-strand cDNA as a template, under the guidance of the primer Tomato Tom1-A and the primer AUAP provided by the above kit: 5'GGCCACGCGTCGACTAGTAC3', the first Th...

Embodiment 2

[0062] Embodiment 2, the cloning of tomato ToTOM1 genome fragment

[0063] According to the obtained full-length cDNA sequence of tomato ToTOM1 and the 23-45 nucleotide sequence from the 5' end and the 1035-1012 nucleotide sequence from the 5' end of the obtained full-length cDNA sequence of tomato ToTOM1 and its coding region, primers were designed to amplify the genome sequence of ToTOM1, The primer sequences are as follows:

[0064] ToTOM1-D: 5'-GAGCTGAAATGGCTAGGTTGCCG-3';

[0065] ToTOM1-E: 5'-CGTTGAATCTTTGCCTTTCCGCAG-3'

[0066] Using the total DNA of tomato as a template, PCR amplification was carried out under the guidance of primers ToTOM1-D and primers ToTOM1-E. After the reaction, the PCR was detected by 0.8% agarose gel electrophoresis, and the detection results were as follows: Figure 5 As shown (lane M is the GeneRuler 1kb DNA ladder, and lane 1 is the genomic fragment of ToTOM1 amplified by PCR), it shows that a specific band with a length of about 6.7kb was a...

Embodiment 3

[0067] Embodiment 3, the acquisition of transgenic tomato plants

[0068] 1. Construction of plant expression vectors

[0069] The binary expression vector used in this example is pBI121 (Clontech), and its physical map is as follows Figure 8 As shown, it has the necessary sequence for T-DNA integration, the kanamycin resistance gene is used as the selection marker gene, and the foreign gene inserted from the multiple cloning site is controlled by the CaMV 35S promoter.

[0070] 1. Construction of a plant expression vector containing an antisense fragment of the ToTOM1 genome gene

[0071] According to the cDNA sequence of the tomato ToTOM1 cloned in Example 2, a pair of specific primers Tomato Tom1-1 (5'-GGGTACCCGAGTATGGCTGGACAAC-3') and Tomato Tom1-2 (5'-CCACCATATAGCAGAAAGCCCAAGG-3') were designed. Using the total DNA of tomato as a template, PCR amplification was carried out under the guidance of primers Tomato Tom1-1 and primer Tomato Tom1-2. After the reaction, the PCR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
Login to View More

Abstract

This invention has disclosed a tomato RNA virus host factor gene and its coding gene and application. Its purpose is to offer a tomato RNA virus host factor gene and its coding gene and application of antivirus plant breeding. This tomato RNA virus host factor gene is a protein with one of amino residues as followed: 1. SEQ ID No.1 in the sequence list;2. Amino residue sequence of SEQ ID No.1 in the sequence list, through substitution by 1 to 10 amino residues, lacunae or addition and protein with virus copy effect.This tomato RNA virus host factor gene, Gene ToTOM1 and method to control this gene's expression, have greater actual meaning and wide application prospect of antivirus plant breeding.

Description

technical field [0001] The invention relates to a protein and its coding gene in the field of biotechnology and a method for cultivating virus-resistant tomato by using the gene. Background technique [0002] Tomato is an important fruit-type vegetable. During its growth and development, it is vulnerable to various diseases, among which viral diseases are the most serious. Most of the viruses infecting tomato reported so far are RNA viruses, of which seven are the most common, namely cucumber mosaic virus (CMV), tobacco mosaic virus (Tabacco mosaic virus, TMV), tomato Tomato mosaic virus (ToMV), Potato virus Y (PVY), Tomato bushy stunt virus (TBSV), Tomato aspermy virus (TAV) and Tomato chlorosis Spot virus (Tomatochlorotic spot virus, TCSV). [0003] Since viruses are strictly obligate parasites, no strictly selective chemical agents can be effectively used for the prevention and treatment of plant virus diseases. In production practice, the hazards of viral diseases ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N15/82A01H1/00
Inventor 陈保善程海荣蒙姣荣刘遥测林海燕
Owner GUANGXI UNIV