ELISA adsorption testing method and for detecting Enterobacter sakazakii and used antibody thereof
A technology of Enterobacter sakazakii and antibodies, which is applied in the field of enzyme-linked immunosorbent assay for the detection of bacteria, and can solve the problem of no prompting antibodies
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Cloning of Enterobacter sakazakii alpha-glucosidase gene
[0027] Take Enterobacter sakazakii ATCC29544 strain (purchasable from American Type Culture Collection (ATCC)) and inoculate it in LB broth, culture overnight at 37°C with shaking at 200rpm, collect the genomic DNA extracted from the bacteria as a PCR template, and clone as follows: Primer pairs for PCR amplification:
[0028] 5'AGGAGGGGTAATGAGTGAAG3', 5'TTGATACCTCACGACGTCAG3'. PCR conditions: 94°C for 5 minutes, 30 cycles (94°C for 30 seconds, 56°C for 90 seconds, 72°C for 60 seconds), 72°C for 5 minutes.
[0029] Agarose electrophoresis recovered a PCR product with a size of about 1677bp, and then used the PCR product as a template to perform PCR amplification with the following expression primer pair, respectively introducing BamHI and XhoI restriction sites: 5'ACTGC ggatccg ATGAGTGAAGCACCGACGCAG3', 5'TCAGTGC ctcgag CGACGTCAGTTTATAAACC3'. The pET22b(+) plasmid (available from Invitrogen) and th...
Embodiment 2
[0030] Example 2 Expression and purification of Enterobacter sakazakii alpha-glucosidase
[0031] Pick the transformant clone verified by Example 1, activate overnight, inoculate in LB broth with 1%, add IPTG at a ratio of 0.5mM / L, induce for 3 hours at 37°C, centrifuge (8000rpm, 5 minutes), discard The cells were collected and frozen at -20°C. The cells were resuspended with 40ml binding buffer (containing 20mM Tris-HCl, 200mM NaCl, pH 8.0), and the cells were disrupted by ultrasonication. Then, it was centrifuged at 13000 rpm for 30 minutes at 4° C., and the supernatant was collected and loaded on SDS-PAGE to observe the induced expression. As a result, as shown in Fig. 1, it was apparent that a protein of about 65 kD (ie, the size of Enterobacter sakazakii α-glucosidase) was expressed.
[0032]Take a Ni-NTA column (available from US PE Company), and equilibrate it with more than 10 column volumes of binding buffer (containing 20 mM Tris-HCl, 200 mM NaCl, pH 8.0). The sup...
Embodiment 3
[0033] Example 3 Preparation of Enterobacter sakazakii alpha-glucosidase antibody
[0034] Using the hybridoma technology described in G.Kohler and C.Milstein (Nature, 256:495-497 (1975)), the difference is that the antigen of the present invention (i.e., expressed and purified Enterobacter sakazakii α- Glucosidase) was used to prepare hybridoma cells through Kunming mice, and 24 hybridoma cell lines were selected.
[0035] Liquid paraffin (0.5ml per mouse) was injected intraperitoneally into the mice first. Seven days later, the hybridoma cell lines were respectively inoculated into the intraperitoneal cavity of mice injected with liquid paraffin, and each mouse was intraperitoneally injected with 1-5×10 6 a hybridoma cell. After 10 to 14 days, ascitic fluid was collected, centrifuged at 10,000 g for 5 minutes, and the supernatant was taken and diluted with an equal volume of pH 7.0 phosphate buffer. After dilution, slowly add saturated ammonium sulfate solution equal to t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
