A recombinant human granulocyte colony-stimulating factor mutant modified by polyethylene glycol and its preparation method
A colony-stimulating factor and polyethylene glycol single technology, applied in the field of protein pegylation modification, can solve the problems of decreased biological activity, subsequent purification and unfavorable clinical application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1 is expressed by the recombinant rmhG-CSF-Cys of prokaryotic expression system 176 preparation of
[0034] rmhG-CSF-Cys 176 The 2nd, 4th, 5th, 6th, and 18th amino acids of rhG-CSF were mutated into Ala, Thr, Tyr, Arg, and Ser, respectively, and an additional cysteine (Cys) was introduced at the C-terminus. The acid sequence and amino acid sequence are as attached figure 1 Described in SeqID No.1 and Seq ID No.2. For the cloning method of rhG-CSF gene, please refer to Chinese patent CN96106418.8. Using this as a template, in order to obtain the expected mutant G-CSF gene, design primers as follows:
[0035] Upstream primer: 5'-ACTAGCCATATGGCACCAACATACCGTGCCAGCTCCCTGCCCCAGAGCTTCTGCTCAAGTCCTTAGAGCAAGTGAGG-3';
[0036] Downstream primer: 5'-AAAGGATCCTTAACAGGGCTGGGCAAGG-3';
[0037] The target gene was amplified by conventional PCR method. After recovery and purification, the PCR product was loaded into pGEM-T vector (purchased from Shanghai Sangon Bioen...
Embodiment 2
[0038] Embodiment 2 is expressed by the recombinant rmhG-CSF-Cys of prokaryotic expression system 140 preparation of
[0039] rmhG-CSF-Cys 140 The 2nd, 4th, 5th, 6th, and 18th amino acids of rhG-CSF were mutated into Ala, Thr, Tyr, Arg, and Ser respectively, and a cysteine (Cys) was mutated at 140th. The nucleotide sequence and amino acid sequence respectively as attached figure 1 Described in Seq ID No.3 and Seq ID No.4 in. For the cloning method of rhG-CSF gene, please refer to Chinese patent CN96106418.8. Using this as a template, in order to obtain the expected mutant G-CSF gene, design primers as follows:
[0040] Upstream primer: 5'-ACTAGCCATATGGCACCAACATACCGTGCCAGCTCCCTGCCCCAGAGCTTCTGCTCAAGTCCTTAGAGCAAGTGAGG-3';
[0041] Downstream primer: Primer 1:
[0042] 5'AAGGATCCGGGCTGGGCAAGGTGGCGTAGAACGCGGTACGACACCCTCCAGGAAGC3';
[0043] Primer 2: 5'TCCAGGAAGCTCTGCAGATGGGAGGCAACCAGGACCCCTCCGCACCGGCGC3';
[0044] The rhG-CSF gene was first amplified by PCR with the downs...
Embodiment 3
[0045] Example 3 PEG-rmhG-CSF-Cys 176 preparation of
[0046]rmhG-CSF-Cys 176 Modification reaction and separation: prepare rmhG-CSF-Cys of 50ml lmg / ml, contain 100mM Bicine (purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.) (pH8.5), then add PEG-MAL at a molar ratio of 5 times 20000 (Nektar). Stir the reaction at room temperature for 24 hours, dilute the reaction product with water to a protein concentration of 0.1mg / ml, adjust the pH to 4.0 with dilute hydrochloric acid, pass through the ion exchange column Resource S, and dissolve in 0-0.5M NaCl, 20mM NaAc (pH4.0) to Step gradient elution, in which the single modified PEG-rmhG-CSF-Cys 176 Under 20% gradient elution, the target peak was subjected to Sephadex G25 desalting chromatography.
[0047] Since PEG-MAL can only specifically interact with rmhG-CSF-Cys 176 The Cys reaction at the end, so the modified rmhG-CSF-Cys is different from the conventional PEG modification and there are multiple m...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More