22 results about "Peg modification" patented technology

This invention relates to the field of acrylic resin technology and discloses a stain-resistant polyethylene glycol-graphene-grafted acrylic resin coating. TEMPO-modified graphene is used as a polymerization carrier, and TEMPO free radicals serve as initiation sites to initiate in-situ chemical grafting polymerization of monomers such as n-butyl acrylate and acrylic acid on the graphene surface, resulting in a polyethylene glycol-graphene-grafted acrylic resin. The graphene is linked to the acrylic resin through polyethylene glycol molecular chains, organically combining the graphene and acrylic resin. This improves the dispersibility of graphene, overcomes its agglomeration in the acrylic resin, and significantly enhances the tensile strength and other mechanical properties of the acrylic resin. Simultaneously, the grafted polar polyethylene glycol molecular chains improve the hydrophilicity and stain resistance of the acrylic resin.

The invention discloses an enzyme-containing anti-inflammatory composition for pet skin and hair follicle health. The enzyme-containing anti-inflammatory composition comprises an enzyme preparation, a hair follicle maintenance agent, a functional auxiliary agent and a carrier raw material. The core innovation lies in that a hair follicle targeted enzymolysis technology is adopted, and a specific enzyme modified by polyethylene glycol can efficiently dredge hair follicles; the anti-inflammatory and hair follicle repairing dual effects are achieved through anti-inflammatory-maintenance synergistic matching and adding sequence optimization; the damaged barrier is rapidly repaired by combining a composite barrier repairing agent and a gradient permeation process; enzyme activity and mildness are guaranteed by adopting a microcapsule embedding and low-temperature preparation technology. The composition can specifically solve the problems of hair follicle blockage, inflammation and unhairing, is suitable for pets of all ages and skin types, and is high in practicability.

The present invention relates to nanoparticles of a metal chosen from among platinum, bismuth or a mixture thereof, which are functionalised at their surface by functionalised polyethylene glycol, comprising in particular at least one OH, COOH, NH2 or SH functional group, and to their method of preparation, which comprises of the following steps:a) Mixing a precursor of nanoparticles with a functionalised polyethylene glycol, in particular comprising at least one OH, COOH, NH2 or SH functional group, in water;b) Exposing the mixture to ionising radiation.

This invention relates to a polyethylene glycol-modified PrRP31, its preparation, and its application. The invention involves modifying PrRP31 with polyethylene glycol and testing its anti-inflammatory activity in a mouse paw edema model and its analgesic activity in a mouse water bath tail-flick experiment. Using polyethylene glycol-modified PrRP31, a mouse paw edema model, and a water bath tail-flick experiment, the anti-inflammatory and analgesic activities of polyethylene glycol-modified PrRP31 were tested. The experiments demonstrated that polyethylene glycol-modified PrRP31 possesses good anti-inflammatory and analgesic activity. In the mouse paw edema model, polyethylene glycol-modified PrRP31 inhibited inflammation by 37.09% (5 h) at a concentration of 5 mg / kg. In the mouse water bath tail-flick experiment, polyethylene glycol-modified PrRP31 produced the maximum analgesic effect at a concentration of 5 mg / kg. This invention provides an application of polyethylene glycol-modified PrRP31 as an anti-inflammatory and analgesic drug, offering beneficial assistance in the treatment of related diseases and possessing significant importance in the pharmaceutical field.

The application provides an organic phosphorus poisoning relief composite enzyme and application thereof, and belongs to the technical field of biological medicine. The organic phosphorus poisoning relief composite enzyme provided by the application comprises polyethylene glycol modified organic phosphorus hydrolase and butyrylcholine esterase, and the mass ratio of the polyethylene glycol modified organic phosphorus hydrolase to the butyrylcholine esterase is (4-8):(2500-10000). The rat acute organic phosphorus poisoning treatment result shows that the organic phosphorus poisoning relief composite enzyme provided by the application fully plays the efficient catalytic hydrolysis capacity of the enzyme as a catalyst, efficiently removes organic phosphorus and acetylcholine by using the organic phosphorus hydrolase and the butyrylcholine esterase respectively, provides a drug combination for treating the cause for the organic phosphorus poisoning injury first aid, and the treatment effect is significantly better than that of the single drug.

The present application is suitable for the technical field of tumor treatment drugs, and provides a metal cobalt-based single-atom nanozyme particle loaded with siRNA and a preparation method and application thereof. The particle is formed by electrostatic combination of siRNA for knocking down a c-Myc gene and a polyethylene glycol modified cobalt-based single-atom nanozyme, wherein the cobalt-based single-atom nanozyme is prepared by calcining Co-doped ZIF-8, cobalt elements are dispersed in a nitrogen-doped carbon carrier in the form of single atoms, and cobalt-nitrogen coordination active sites are formed. The preparation process includes three steps of synthesis of the cobalt-based single-atom nanozyme, polyethylene glycol modification and siRNA loading, and is simple in process, convenient in operation, does not require complex and expensive equipment, and is easy for industrialized production. It is verified by experiments that the particle has reliable safety and significant effectiveness in the treatment of cholangiocarcinoma, can effectively inhibit the growth of cholangiocarcinoma solid tumors, is suitable for the treatment of malignant tumors, and has a broad application prospect.

The invention belongs to the technical field of active polypeptides, and particularly relates to a polyethylene glycol modified anti-tumor active polypeptide and application thereof. The modified polypeptide provided by the invention has unexpected better anti-tumor activity, in-vivo stability and low hemolytic activity, and has good application potential.

The present application relates to the technical fields of nanomedicine and functional nanomaterials, and discloses a mesoporous core-shell structure nanoenzyme with multiple enzyme activities as well as a preparation method and application thereof, the nanoenzyme takes gold nanorods as an inner core and iridium and its oxide as an outer shell, the outer shell is modified by polyethylene glycol and then loaded with a photosensitizer chlorin e6 to form an AuNR@Ir / IrO2-PEG / Ce6 nanoenzyme, the nanoenzyme has high catalase (CAT) activity, can decompose hydrogen peroxide (H2O2) in a tumor microenvironment and generate oxygen (O2) in situ, effectively improves the treatment effect of photodynamic therapy (PDT), and through the synergistic effect of photodynamic therapy (PDT) and photothermal therapy (PTT) combined with photoacoustic imaging function, provides a brand-new diagnosis and treatment integrated solution for efficient treatment and microenvironment regulation of tumors, and effectively makes up for the defects of insufficient enzyme activity and low photothermal conversion efficiency of the prior art.

The present application relates to the field of biological medicine, and more particularly to a nano-composite system for treating vitiligo, an intelligent controlled-release microneedle patch and a preparation method thereof, wherein the nano-composite system contains enzyme-responsive micelles and polyethylene glycol modified polydopamine nanoparticles; the enzyme-responsive micelles are formed by glyceryl monostearate encapsulating ginseng root-derived exosomes; and the polyethylene glycol modified polydopamine nanoparticles are formed by covalent connection of a polydopamine core and methoxy-polyethylene glycol-amine. Compared with the prior art, the nano-composite system of the present application can realize the spatiotemporal programmed release of drugs in response to the pathological microenvironment, wherein the polydopamine nanoparticles provide instant antioxidant effect, and the exosome micelles trigger release under the condition of overexpression of matrix metalloproteinase-9, thereby synergistically exerting anti-inflammatory and promoting pigment regeneration effects; animal experiments have proved that the patch can effectively reverse the white spots and realize the recoloring of hair and skin. The microneedle patch thus prepared can realize transdermal self-administration, is convenient and painless.

A lipid nanoparticle composition for nucleic acid drug delivery, a preparation method therefor, and use thereof. A composition prepared by mixing a steroid-cationic lipid compound with an auxiliary phospholipid and a polyethylene glycol-modified phospholipid has relatively good stability and transfection efficiency. By using lipid nanoparticles for delivering a nucleic acid, such as mRNA, a nucleic acid drug can be efficiently and stably delivered to a target cell or organ. Moreover, such LNPs can be used for the atomized inhalation administration of mRNA and the development of lyophilized formulations of mRNA. A relatively high specific antibody response can be induced in experimental animals, and the compound has better safety.

The invention provides a microwave hyperthermia sensitization polyamino acid material. The polyamino acid material is selected from at least one of polyamino acid, polyamino acid salt or polyethylene glycol modified polyamino acid. According to the polyamino acid material provided by the invention, the microwave heat production temperature is remarkably increased by 5-8 DEG C compared with that of a traditional mode, and the excellent biological safety of the material is utilized to realize the application of efficient fat decomposition, so that the core problems of low fat dissolving efficiency and insufficient energy conversion rate in an existing microwave fat dissolving technology are solved; finally, the purposes of reducing treatment times and improving clinical effects are achieved.

The application discloses a polyethylene glycol modified iridium coordination compound and a preparation and application thereof. The polyethylene glycol modified iridium coordination compound has the structure shown in the following formula I. The polyethylene glycol modified iridium coordination compound can self-assemble to form nanomicelles, and can be used for precise positioning of tumors after intravenous injection. The polyethylene glycol modified iridium coordination compound can also be combined with a polyethylene glycol modified indocyanine green to form a composition, the composition can self-assemble to form composite nanomicelles, and can be used for precise positioning of tumors after intravenous injection, and can be further used for photothermal treatment of tumors.

This invention discloses a podophyllotoxin-9-fluorenylmethanol small molecule prodrug nanoparticle, its preparation method, and its applications. The podophyllotoxin-9-fluorenylmethanol small molecule prodrug co-assembled nanoparticles are either polyethylene glycol-modified podophyllotoxin-9-fluorenylmethanol small molecule prodrug co-assembled with gossypol, or podophyllotoxin-9-fluorenylmethanol small molecule prodrug co-assembled with gossypol and loaded with hydrophobic fluorescent substances. The podophyllotoxin-9-fluorenylmethanol small molecule prodrug is prepared by linking podophyllotoxin and its compounds with 9-fluorenylmethanol via disulfide bonds. This invention is the first to construct a carrier-free hybrid nanoassembly of gossypol and PPT oxidation-sensitive prodrug. Gossypol-mediated prodrug co-assembled nanoparticles can be used for precision cancer chemotherapy in tumor treatment, precisely achieving PPT "enhancement," improving the therapeutic efficiency of PPT prodrugs, opening an ultra-low-dose chemotherapy window for PPT, and solving the problems of delayed and insufficient prodrug activation.

The invention relates to the field of biological materials, in particular to a preparation method for wrapping vitamins with artificially synthesized needle-shaped silicon dioxide, which comprises the following steps: performing ultrasonic impurity removal on the artificially synthesized needle-shaped silicon dioxide by using a sodium carbonate aqueous solution, and cleaning by using deionized water; mixing a polyethylene glycol modifier with deionized water according to a ratio of 1: 30-1: 50, adding the mixture into needle-like silicon dioxide, carrying out ultrasonic treatment, and then carrying out ultrasonic washing with deionized water; and mixing the vitamin solution with the needle-like silicon dioxide, heating, stirring for a period of time, and naturally drying to obtain the needle-like silicon dioxide coated with the vitamin. The preparation method has the beneficial effects that the vitamin-coated needle-like silicon dioxide which is good in coating effect, stable in performance and capable of being industrially produced on a large scale is obtained.

This invention provides a yly12 nucleic acid aptamer containing a single-stranded DNA with the following sequence: 5'-HS-SH-(CH2)6-T MB TTTTTTTTAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTG GTGGGTCTTCTG-3'. This invention also provides a GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor, its preparation, detection, and application. This invention combines the redox properties of DSPE-PEG molecules with ratiometric electrochemical sensing technology. The complex formed by DSPE-PEG modification not only achieves stable electrochemical signal output but also significantly enhances the detection signal of L1CAM-EVs. This invention constructs a sensitive, efficient, and easy-to-operate electrochemical detection strategy, providing a novel approach and technical support for the accurate detection of L1CAM-EVs.

The invention discloses a nanoimprint photo-thermal chip for CRISPR / Cas9 gene editing and a preparation method and application thereof.The chip comprises a substrate layer and a nanostructure layer on the substrate layer, the nanostructure layer is a gold nanocolumn array prepared through a nanoimprint technology, and the surface of the nanostructure layer is modified through polyethylene glycol to increase hydrophilicity. Under the irradiation of near-infrared laser, the chip can improve the local temperature through the local surface plasma resonance effect and the photo-thermal responsiveness, and is used for instantaneously disturbing cell membranes of cells attached to the chip, so that the cytoplasm delivery and metabolism activation of a CRISPR / Cas9 gene editing compound are realized. The method realizes space-time controllable operation of gene editing, has the advantages of high efficiency, high cell activity and cross-species universality, and has wide application prospects in the fields of gene therapy, cell engineering and biological medicine.

The application relates to the application material field and discloses a tellurium-bismuth-biomineralization in-vivo stable deposition material and a preparation method, which comprises a nano core with a particle size of 20-100 nm, a PEG modification layer with a molecular weight of 2000-10000 Da and a calcium phosphate mineralization shell with a thickness of 5-15 nm. The tellurium-bismuth-biomineralization in-vivo stable deposition material provided by the application can be stably present in the body, has good targeting property and low toxicity.

The application discloses a kind of immobilized enzyme, based on the method and device of bio-oil of the enzyme can be reused, the immobilized enzyme is with polyethylene glycol modified Fe3O4 Nanoparticle as matrix, matrix first adsorbs and loads first part free protease, then it is dispersed in sodium alginate aqueous solution with second part free protease and mixed uniformly, sequentially through Ca 2+ Two-step action process of ion hardening and glutaraldehyde crosslinking reaction, the outer sodium alginate reaction forms reticulated macroporous gel microspheres, finally after washing, drying, the microsphere complex of embedding second part free protease and polyethylene glycol modified nano Fe3O4 load immobilized protease is prepared.The stability of the immobilized enzyme in the non-homogeneous slurry mixing system, in-situ separation convenience greatly improves, immobilized enzyme can be better reused, in addition, the stirring paddle of bio-oil reactor is improved, and the stability of immobilized enzyme use can be further improved.

The invention relates to the technical field of nano medicine and functional nano materials, and discloses a mesoporous core-shell structure nano enzyme with multi-enzyme activity and a preparation method and application thereof.According to the nano enzyme, a gold nanorod serves as an inner core, iridium and iridium oxide serve as a shell, the shell is modified through polyethylene glycol and then loaded with a photosensitizer chlorin E6, and AuNR (at) Ir / IrO2-PEG / Ce6 nano enzyme is formed; the compound has efficient catalase (CAT) activity, hydrogen peroxide (H2O2) in a tumor microenvironment can be decomposed, oxygen (O2) can be generated in situ, the treatment effect of photodynamic therapy (PDT) is effectively improved, meanwhile, the photoacoustic imaging function is combined with the synergistic effect of the photodynamic therapy (PDT) and photothermal therapy (PTT), and the photoacoustic imaging effect is improved. A brand new diagnosis and treatment integrated solution is provided for efficient treatment and microenvironment regulation of tumors, and the defects of insufficient enzyme activity and low photothermal conversion efficiency in the prior art are effectively overcome.

The invention relates to a medical nano-enzyme for treating deep tissue drug-resistant bacterium infection, a preparation method and application thereof and a medicine, and belongs to the field of biological medicine. At least one of the problems that in the prior art, when deep tissue drug-resistant bacterium infection is treated, the antibacterial and anti-biofilm effects are poor, the deep tissue penetrating capacity is insufficient, the inflammation regulation and control and tissue repair functions are lacked, the biological safety risk is high, and the material preparation cost is high is solved. The invention relates to a medical nano-enzyme for treating deep tissue drug-resistant bacterium infection. The medical nano-enzyme is a monatomic rhodium catalyst which is modified by polyethylene glycol and is loaded by nitrogen-doped carbon. The medical nano-enzyme provided by the invention realizes excellent antibacterial and anti-biofilm effects in vivo and in vitro, can regulate and control an inflammatory microenvironment and promote tissue repair, and is good in biocompatibility and strong in tissue penetrating power.

The present application relates to the technical field of nanomaterial preparation, and particularly relates to a preparation method of water-soluble azacyclo carbene modified gold nanoparticles. 5-ethynyl-1-methyl-1H imidazole is used as a starting compound, polyethylene glycol modified azacyclo carbene imidazole salt is obtained through alkylation and click reaction, then silver complex is generated through reaction of the imidazole salt and silver oxide, metal conversion of the synthesized silver complex with dimethyl sulfur gold chloride is carried out to obtain gold complex, and finally ligand exchange is carried out in an aqueous solution through the gold complex and citric acid modified gold nanoparticles to obtain azacyclo carbene modified gold nanoparticles. The preparation method is simple and fast, has high yield, does not need to add a reducing agent additionally, has the characteristics of green environmental protection, and the target product prepared has high water solubility, good biocompatibility and uniform morphology.

The invention belongs to the technical field of biomedical nano materials, and particularly relates to a preparation method and a composition of an albumin-based polyethylene glycol diphosphate modified manganese dioxide methylene blue nano suspension. Comprising the following steps: S1, carrying out ultrafiltration on a MnO2 precursor solution of which the pH value is adjusted so as to separate out MnO2 precipitates; the method comprises the following steps: mixing a MnO2 solution and a BSA solution according to a volume ratio of 1: 5, and carrying out water bath ultrasonic treatment to obtain a BSA-MnO2 nanoparticle suspension stably dispersed in a liquid phase; s2, DP-PEG modification treatment: taking an LDP-PEG solution, slowly adding the LDP-PEG solution into the prepared BSA (at) MnO2 nano suspension, and carrying out ultrafiltration and centrifugation to obtain a (DP-PEG)-BSA (at) MnO2 solution; and S3, carrying out methylene blue loading treatment: uniformly mixing the (DP-PEG)-BSA-coated MnO2 solution and a methylene blue aqueous solution according to a mass ratio of 1: 3 and a concentration ratio of 3: 1, and continuously stirring for 6 hours to prepare the MB / (DP-PEG)-BSA-coated MnO2 nano suspension. The polymer is stable in physicochemical property and high in biocompatibility, and has the functions of naked eye staining marking and CT / MR bimodal development.