Inhibin DNA vaccine capable of improving animal fertility, and preparation and use thereof
A DNA vaccine and inhibin technology, applied in recombinant DNA technology, DNA/RNA fragments, microorganism-based methods, etc., can solve the problems of limited immune pathways, unusable product development, and inconvenient use, and achieve a simple preparation process. , the effect of good safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] The construction of embodiment 1 eukaryotic expression plasmid vector pVAX-asd
[0028] 1. Aspartate β-galactose dehydrogenase gene (asd) gene cloning and sequence analysis
[0029]Using Primer5.0 primer design software, according to the Salmonella asd gene sequence registered in GenBank (AF015781), a primer pair was designed (forward primer: P1 ATGCAGCTGGCACATCTCTTTGCAGG; reverse primer: P2 TTACAGCTGCTACGCCAACTGGCGCA), with the PYA3493 plasmid (Kang HY et al., Immune responses to recombinant pneumococcal PspA antigen delivered by liveattenuated Salmonella enterica serovar typhimurium vaccine. Infect Immun, 2002, 70(4): 1739-49.) was used as a template, and the asd gene fragment of Salmonella typhimurium was cloned by PCR method. The homology of the asd gene between Salmonella typhimurium and Salmonella choleraesuis is 100%, and its cDNA open reading frame is 1107bp, encoding 368 amino acids. Using the PYA3493 plasmid as a template, the asd gene fragment was fully ampl...
Embodiment 2
[0067] The construction of embodiment 2 inhibin eukaryotic expression plasmid pXAIS (see image 3 )
[0068] 1. Extraction and purification of eukaryotic expression plasmid vector pVAX-asd
[0069] Pick a single colony of the newly activated eukaryotic expression plasmid vector pVAX-asd from the LB plate, inoculate it into 10 mL of LB liquid medium, cultivate it overnight at 37°C and 240 rpm, and dilute it into an appropriate volume of LB at a volume ratio of 1:250 , continue culturing for 12 hours, collect the cells by centrifugation, and extract and purify the eukaryotic expression plasmid vector pVAX-asd.
[0070] 2. Preparation of inhibin fusion gene fragments
[0071] The inhibin fusion expression plasmid PCIS (Han L et al., Development and evaluation of novel DNA vaccine expressing inhibin alpha (1-32) fragment for improving the fertility in ratsand sheep. Animal reproduction science, 2008, 109 ( 1-4): 251-65) can obtain 858bp inhibin and hepatitis B surface antigen (...
Embodiment 4
[0101] Example 4: Detection of in vitro protein expression of inhibin eukaryotic expression plasmid pXAIS plasmid
[0102] 1. Detection of transcription level after inhibin eukaryotic expression plasmid pXAIS transfected cells:
[0103] Use a plasmid extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) to extract the plasmid, and when the monolayer of PK15 cells (normal wild boar kidney cells) grows to 60%-70%, press the liposome transfection kit (purchased from Invitrogen Company) instructions for transfection. After 48 hours of transfection, PK15 cells were digested with trypsin and collected. According to the instruction manual of Trizol (purchased from Invitrogen Company), the mRNA of the cells was extracted, reverse-transcribed to obtain cDNA, and amplified according to inhibin primers.
[0104] Using the cDNA obtained by reverse transcription as a template, use INH primers (INHP1: TGCTGGATATCTGCAGAATTCCCT, INHP2: CTTCTCGAGATCTGTGGCAGTCGG. ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap