Check patentability & draft patents in minutes with Patsnap Eureka AI!

Inhibin DNA vaccine capable of improving animal fertility, and preparation and use thereof

A DNA vaccine and inhibin technology, applied in recombinant DNA technology, DNA/RNA fragments, microorganism-based methods, etc., can solve the problems of limited immune pathways, unusable product development, and inconvenient use, and achieve a simple preparation process. , the effect of good safety

Inactive Publication Date: 2009-04-15
HUAZHONG AGRI UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, since the inhibin fusion expression plasmid (pCIS) previously constructed: ① contains resistance genes such as kanamycin gene or ampicillin gene; ② the cloned plasmid DNA must be extracted and purified before it can be used for immunization, the cost of purification Very high; ③The immune route is limited to intramuscular injection, which is inconvenient to use and can only be used for experimental research, not for product development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Inhibin DNA vaccine capable of improving animal fertility, and preparation and use thereof
  • Inhibin DNA vaccine capable of improving animal fertility, and preparation and use thereof
  • Inhibin DNA vaccine capable of improving animal fertility, and preparation and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The construction of embodiment 1 eukaryotic expression plasmid vector pVAX-asd

[0028] 1. Aspartate β-galactose dehydrogenase gene (asd) gene cloning and sequence analysis

[0029]Using Primer5.0 primer design software, according to the Salmonella asd gene sequence registered in GenBank (AF015781), a primer pair was designed (forward primer: P1 ATGCAGCTGGCACATCTCTTTGCAGG; reverse primer: P2 TTACAGCTGCTACGCCAACTGGCGCA), with the PYA3493 plasmid (Kang HY et al., Immune responses to recombinant pneumococcal PspA antigen delivered by liveattenuated Salmonella enterica serovar typhimurium vaccine. Infect Immun, 2002, 70(4): 1739-49.) was used as a template, and the asd gene fragment of Salmonella typhimurium was cloned by PCR method. The homology of the asd gene between Salmonella typhimurium and Salmonella choleraesuis is 100%, and its cDNA open reading frame is 1107bp, encoding 368 amino acids. Using the PYA3493 plasmid as a template, the asd gene fragment was fully ampl...

Embodiment 2

[0067] The construction of embodiment 2 inhibin eukaryotic expression plasmid pXAIS (see image 3 )

[0068] 1. Extraction and purification of eukaryotic expression plasmid vector pVAX-asd

[0069] Pick a single colony of the newly activated eukaryotic expression plasmid vector pVAX-asd from the LB plate, inoculate it into 10 mL of LB liquid medium, cultivate it overnight at 37°C and 240 rpm, and dilute it into an appropriate volume of LB at a volume ratio of 1:250 , continue culturing for 12 hours, collect the cells by centrifugation, and extract and purify the eukaryotic expression plasmid vector pVAX-asd.

[0070] 2. Preparation of inhibin fusion gene fragments

[0071] The inhibin fusion expression plasmid PCIS (Han L et al., Development and evaluation of novel DNA vaccine expressing inhibin alpha (1-32) fragment for improving the fertility in ratsand sheep. Animal reproduction science, 2008, 109 ( 1-4): 251-65) can obtain 858bp inhibin and hepatitis B surface antigen (...

Embodiment 4

[0101] Example 4: Detection of in vitro protein expression of inhibin eukaryotic expression plasmid pXAIS plasmid

[0102] 1. Detection of transcription level after inhibin eukaryotic expression plasmid pXAIS transfected cells:

[0103] Use a plasmid extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) to extract the plasmid, and when the monolayer of PK15 cells (normal wild boar kidney cells) grows to 60%-70%, press the liposome transfection kit (purchased from Invitrogen Company) instructions for transfection. After 48 hours of transfection, PK15 cells were digested with trypsin and collected. According to the instruction manual of Trizol (purchased from Invitrogen Company), the mRNA of the cells was extracted, reverse-transcribed to obtain cDNA, and amplified according to inhibin primers.

[0104] Using the cDNA obtained by reverse transcription as a template, use INH primers (INHP1: TGCTGGATATCTGCAGAATTCCCT, INHP2: CTTCTCGAGATCTGTGGCAGTCGG. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the preparation technical field of animal vaccines, and particularly relates to a pig cholera salmonella inhibin DNA vaccine which does not contain the residue of antibiotics genes and can improve the propagating fecundity of the animals as well as the preparation and applications thereof. A pig inhibin Alpha (1-32) gene and a hepatitis b surface antigen fusion gene are inserted into a plasmid vector pVAX1 which is lack of a kanamycin resistance gene for obtaining the eukaryotic expression plasmid pXAIS of the inhibin; and the eukaryotic expression plasmid pXAIS of the inhibin is transfected into the pig cholera salmonella C500 for constructing the pig cholera salmonella inhibin DNA vaccine. Compared with the prior art, the vaccine does not contain the residue of antibiotics genes and has the advantages of high moving efficiency, simple immune method and good immune effect. The vector bacteria self can be used as immune adjuvant which can simultaneously activate mucosal immunity and general immunity, and can obtain the immunity to the vector bacteria, and the like.

Description

technical field [0001] The invention relates to the construction and application of an animal inhibin DNA vaccine, in particular to a Salmonella choleraesuis inhibin DNA vaccine which has no antibiotic gene residue and improves animal fecundity, as well as its preparation method and application. technical background [0002] Inhibin (inhibin-INH) is a glycoprotein hormone secreted by the ovary, which can inhibit the secretion of pituitary follicle-stimulating hormone (FSH), and plays an important role in the regulation of follicle development. Many experiments have proved that active or passive immunization of animals with INH can promote follicular development, induce multiple ovulation, increase litter size, and induce twinning in singleton animals (Medan MS, et al. The effect of active immunization against hibin on gonadotropin secretions and Follicular dynamics during the estrous cycle in cows.J Reprod Dev.2006,52(1):107-13; Medan MS et al.Effect of active immunization a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/62C12N15/79A61K39/00A61P43/00C12R1/42
Inventor 杨利国韩丽梁爱心王庆玲甄艳红
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More