Streptomyces clavuligerus, as well as preparation method and application
A technology of Streptomyces coryneformis and strains, applied in the field of biopharmaceuticals, can solve problems such as less research, and achieve the effects of improving growth conditions, increasing yield, and reducing energy consumption
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Construction of vhb gene integrated vector
[0031] Primers were designed according to the DNA sequence of the vhb gene (M27061) of Vitreoscilla stercoraria, and the vhb gene fragment was amplified in vitro by PCR using the total DNA of Vitreoscilla stercoraria as a template, and the PCR product was purified.
[0032] According to the analysis of the vhb gene sequence encoded by Vitella hyaline, two primers for PCR amplification of the vhb gene were designed as follows:
[0033] vhb-up: CGCGGATCCAAGCTTACAGGACGCTGGGG
[0034] vhb-down: CCGGAATTCATGCCAAGGCACACCTGAAG
[0035] The PCR product was double-digested with BamHI and EcoRI, and then inserted into the same double-digested pSET152 plasmid. Positive clones were obtained by blue-white screening, and the plasmid was extracted, verified by BamHI and EcoRI double-digestion, and the double-digested product fragments were detected by electrophoresis. The size was about 1.4kb as expected, and the constructed insertion vec...
Embodiment 2
[0036]Embodiment 2 protoplast screening transformation strain
[0037] Preparation of Streptomyces protoplasts
[0038] Add 100ml YEME+TSBY (1:1) and 0.2% glycine to a 250ml Erlenmeyer flask equipped with a stainless steel spring, inoculate 100ul of spore suspension, and incubate at 30°C at 200rpm for 36h-40h. Then the mycelium was collected, and the collected mycelium was washed with 10.3% sucrose solution for three times, and the mycelium was collected by centrifugation at 3000 rpm for 10 min. Take the mycelium, add the P buffer of lysozyme, and put it in a water bath at 30°C for 30-60min until the supernatant becomes milky. Filter with a test tube equipped with absorbent cotton, transfer the filtrate to a sterile universal, and centrifuge at 3000 rpm for 7 minutes to collect the protoplast precipitate, which is yellow. Gently break up the protoplasts, wash with P buffer to remove lysozyme, centrifuge under the same conditions, collect the protoplasts, remove the supernata...
Embodiment 3
[0042] Fermentation Detection of Genetically Engineered Bacteria
[0043] Fermentation tank experiments were carried out on the screened engineered bacteria to detect their ability to produce clavulanic acid under the condition of reducing aeration. The original strain was used as the control strain, the soybean medium was selected as the fermentation medium, the inoculum amount was 5% in a 30L fermenter, cultured at 28°C, and the fermentation was carried out under the condition that the ventilation rate was reduced by 30%. Samples were taken after fermentation, and the content of clavulanic acid was detected by HPLC. The detection results showed that compared with the original strain, Streptomyces clavulatus LNSC maintained the same fermentation level when the aeration volume was reduced by 30%.
[0044] Table 1 The content of clavulanic acid in the fermentation broth detected by HPLC
[0045]
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com