Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Streptomyces clavuligerus, as well as preparation method and application

A technology of Streptomyces coryneformis and strains, applied in the field of biopharmaceuticals, can solve problems such as less research, and achieve the effects of improving growth conditions, increasing yield, and reducing energy consumption

Active Publication Date: 2009-05-20
LUNAN PHARMA GROUP CORPORATION
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, the research on the hemoglobin of Vibrella hyaline is mainly the molecular biological properties, mechanism of action, etc., and there are few researches on the application, especially in the transformation of industrial production strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptomyces clavuligerus, as well as preparation method and application
  • Streptomyces clavuligerus, as well as preparation method and application
  • Streptomyces clavuligerus, as well as preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Construction of vhb gene integrated vector

[0031] Primers were designed according to the DNA sequence of the vhb gene (M27061) of Vitreoscilla stercoraria, and the vhb gene fragment was amplified in vitro by PCR using the total DNA of Vitreoscilla stercoraria as a template, and the PCR product was purified.

[0032] According to the analysis of the vhb gene sequence encoded by Vitella hyaline, two primers for PCR amplification of the vhb gene were designed as follows:

[0033] vhb-up: CGCGGATCCAAGCTTACAGGACGCTGGGG

[0034] vhb-down: CCGGAATTCATGCCAAGGCACACCTGAAG

[0035] The PCR product was double-digested with BamHI and EcoRI, and then inserted into the same double-digested pSET152 plasmid. Positive clones were obtained by blue-white screening, and the plasmid was extracted, verified by BamHI and EcoRI double-digestion, and the double-digested product fragments were detected by electrophoresis. The size was about 1.4kb as expected, and the constructed insertion vec...

Embodiment 2

[0036]Embodiment 2 protoplast screening transformation strain

[0037] Preparation of Streptomyces protoplasts

[0038] Add 100ml YEME+TSBY (1:1) and 0.2% glycine to a 250ml Erlenmeyer flask equipped with a stainless steel spring, inoculate 100ul of spore suspension, and incubate at 30°C at 200rpm for 36h-40h. Then the mycelium was collected, and the collected mycelium was washed with 10.3% sucrose solution for three times, and the mycelium was collected by centrifugation at 3000 rpm for 10 min. Take the mycelium, add the P buffer of lysozyme, and put it in a water bath at 30°C for 30-60min until the supernatant becomes milky. Filter with a test tube equipped with absorbent cotton, transfer the filtrate to a sterile universal, and centrifuge at 3000 rpm for 7 minutes to collect the protoplast precipitate, which is yellow. Gently break up the protoplasts, wash with P buffer to remove lysozyme, centrifuge under the same conditions, collect the protoplasts, remove the supernata...

Embodiment 3

[0042] Fermentation Detection of Genetically Engineered Bacteria

[0043] Fermentation tank experiments were carried out on the screened engineered bacteria to detect their ability to produce clavulanic acid under the condition of reducing aeration. The original strain was used as the control strain, the soybean medium was selected as the fermentation medium, the inoculum amount was 5% in a 30L fermenter, cultured at 28°C, and the fermentation was carried out under the condition that the ventilation rate was reduced by 30%. Samples were taken after fermentation, and the content of clavulanic acid was detected by HPLC. The detection results showed that compared with the original strain, Streptomyces clavulatus LNSC maintained the same fermentation level when the aeration volume was reduced by 30%.

[0044] Table 1 The content of clavulanic acid in the fermentation broth detected by HPLC

[0045]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of microbial engineering, provides a streptomyces clavuligerus strain LNSC with low oxygen consumption and high fermentation yield, a strain preparation method and application of the strain, and particularly relates to a method. The method utilizes genetic engineering methods, researches the application aspect of vitreoscilla hemoglobin gene (vhb), transfers the gene into the streptomyces clavuligerus culture that is used for clavulanic acid production, obtains high expression of VHB protein, thus improving the production characteristics of the streptomyces clavuligerus, and lowering the energy consumption of zymolytic production.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, and relates to a streptomyces clavulus, in particular to a streptomyces clavulus constructed by a genetic engineering method. The invention also relates to the preparation method and application of the Streptomyces clavulus. Background technique [0002] β-lactam antibiotics, such as penicillins, cephalosporins, and cephalosporins, are the most widely used antibiotics in clinical practice. However, due to the emergence of pathogenic bacteria resistance, the use of such antibiotics has been greatly affected. The main reason for the drug resistance of pathogenic bacteria is the β-lactamase produced by it, which inactivates the β-lactam ring of β-lactam antibiotics by destroying them. Clavulanic acid is a natural β-lactamase inhibitor produced by Streptomyces clavulicularis, which can irreversibly bind to the serine active site of β-lactamase to protect the activity of β-lactam antibiotics. Clin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P17/18C12R1/465
Inventor 赵志全
Owner LUNAN PHARMA GROUP CORPORATION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products